focal volume measurement of a beam.
Hi everyone, Recently I have been conducting Dynamic Light scattering experiments in a micellar solution at 5 and gel at 37 degrees of Celsius with latex particles of diameter 190-500 nm. While...
01 August 2024 1,168 4 View
Hi there, My question is: What standard curves should be used while estimating Tot GSH and GSSG by kinetic method using GR enzyme mediated recyling with DTNB chromophore? Actually I am following...
01 August 2024 8,217 1 View
I'd like to know if anyone has got experience in intracerebroventricular (ICV) AAV inj. I am looking for a concomitant spread of the AAV including but not limited to the motor cortex and the...
12 July 2024 781 0 View
In research papers on beam steering antennas, while the radiation pattern for the beam scanning plane (such as the horizontal or vertical plane) is typically presented, details regarding the...
03 July 2024 8,321 0 View
If I want to increase the photocatalytic activity of a thin film sample what should be it's ideal surface morphology and parameters? All scientific answers related this are highly appreciated.
19 June 2024 6,744 0 View
>Error # 7202. Command name: GET STATA >Input dictionary read error. >Execution of this command stops. Cross Product Matrices are not supported
19 June 2024 5,423 0 View
If I want to improve the photocatalytic activity of Ni doped ZnO thin film then which would be the better deposition process for thin film Spin Coating or Dip Coating?
18 June 2024 7,678 2 View
If I want to enhance the photocatalytic activity of Ni doped ZnO thin film. For this what are the parameters I need to tune and how? Related this all scientific answers/explanations are highly...
16 June 2024 4,533 1 View
Also, I will appreciate whole curing mechanism of Novolak with Hexamine
14 June 2024 9,908 0 View
From the definition of cell line, they are indefinitely propagated/subcultured. However, in practice beyond a certain passage number, they are said to loose characteristic gene profile, for e.g....
10 June 2024 6,890 1 View
Hello, I'm trying to measure the conductivity of semiconductor films but since I don't have a commercial four point probe set up I would like to build one on my own in my lab. I have generators,...
30 July 2024 906 2 View
I designed 2 dual hybridization probes for my single SNP. where I attach my fluorophore 5'-FAM-nnnn-BHQ1-3', and 5'-HEX-nnnnnn-BHQ2-3'. I need to run it on the MIC RT PCR machine by Biomolecular...
28 July 2024 5,658 0 View
Dear colleagues, We are trying to do FISH on mice PDEC metaphase spreads. We use homemade biotin labelled probes, synthetized using a nick translation kit. For hybridization, initially we were...
08 July 2024 8,687 3 View
I have a target of sequences for primer design for qPCR with taqman. The issue is that when I design a sense probe the probe makes dimers with forward and reverse with a very high probability at...
16 June 2024 1,506 1 View
Hi all, you know this lncRNA has 12 exons and 50 isoforms that just have similar sequences in exon 12. Coud someone recommend me primers for this exon with no need of probes?
15 June 2024 8,055 0 View
It is very common to measure the pressure distribution inside the bearings with pressure probes connected to the oil film through holes in the bush. Once filled and pressurized, the probe lines...
12 June 2024 1,936 0 View
I was recently performing a great deal of qPCRs on adipose tissue derived RNA. I had experimental samples from sick, and control samples from healthy individuals. I used the same chemistry for all...
04 June 2024 6,924 0 View
this primer and probe are specific to the mthfr gene (C677T) AGGCCAGCCTCTCCTGACTG AGGACGGTGCGGTGAGAGTG Taq man probe: CGGGAGCCGATTTCATCA—FL 640-CGCAGCTTTTCTTTGAGGCTGACA—PH
03 June 2024 239 2 View
Hi, I am looking for some low molecular weight organic compound/dye that absorbs light above 600 nm up to 750 nm with a decent absorptivity, that is reactive to amines or has a carboxilic acid...
22 May 2024 2,803 5 View
