I used total RNA extracted from PBMC(blood WBCs) by kit.
Then I synthesized cDNA of ARSB gene once using random hexamer primer and the other time by mixture of oligodt and random hexamer primer.
Primer length(with restriction site) :27- 28
Tm without restriction site:59-60
PCR condition:
Taq polymerase master mix 10ul
cDNA 2 ul
DW 6ul
Primers 2ul
95 30s-(95.1min-60 1min -72.1:30)72 10min 40 CYCLES
Result: I just got some nonspecitic bands about 300bp
(I checked my primers specificity in NCBI and they were OK)
ّF:CGGGATCCTATCAGCGGTACAAGGGGC
R:CCGCTCGAGCCTGAGGTCCAACTTCCAA
1) Have you tried to use the primers to amplify from gDNA? If it is amplifiable (results in one band only), then it means that your primers are ok.
2) Check the quality of your cDNA using gel electrophoresis
@Vikki Wong
Thanks for your answer
1.ARSB gene is about 5kb ,so I didnt tried using gDNA
2.You mean running the cDNA on gel?
I used GAPDH primers for pcr and then used electrophoresis the product for checking cDNA quality
Where do your primers anneal? They need to be in the transcribed region of your gene to product a product from cDNA. I'd also test them out on gDNA. 5kb isn't too large to amplify. You'll need to increase the extension time though.
I'd also increase your reaction volume to 50 ul. In general, you will get better amplification with a larger reaction.
Good luck!
- Badges
- Science method