Dear all,
We'd like to sequence immunoglobulin repertoire using Illumina MiSeq. I obtained the primer sequences from a book chapter entitled "Assessment of B Cell Repertoire in Humans" (Methods Mol Biol. 2015;1343:199-218. doi: 10.1007/978-1-4939-2963-4_16). Here is the primer for IgG sequencing:
We have six forward primers that we mix and add to PCR reaction:
IGHV1 CCTCAGTGAAGGTCTCCTGCAAGG
IGHV2 TCCTGCGCTGGTGAAACCCACACA
IGHV3 GGTCCCTGAGACTCTCCTGTGCA
IGHV4 TCGGAGACCCTGTCCCTCACCTGC
IGHV5 CAGTCTGGAGCAGAGGTGAAA
IGHV6 CCTGTGCCATCTCCGGGGACAGTG
and we have only one reverse primer:
RevIgG: GCGCCTGAGTTCCACGACAC
Supposedly, when sequencing performed using those primers I should get full length information about the Ig variable region (complete V, D and J sequences). I'd like to test in silico where exactly those primers bind and what is the amplicon that will be generated in these PCR?
Is there anyway to test this exactly? I used Ig-Blast webpage and saw where primers are binding. However, I couldn't get the bigger picture. Is there anyone experience in this topic that can help me?
Thank you very much.
Best wishes,
Bahti
Hi Bahti,
The forward primers you have will bind in framework region 1, and the reverse primer will bind about 125 bp inside the constant region. Your amplicons will therefore be ~450 bp long, and cover the majority of the variable region. This will give sufficient information to identify V/D/J segment, CDR1/2/3 sequences, and determine IgG subclass.
Regards,
Jake
IgBlast can tell you where in each V gene the primers bind (and how good the alignment is to each V gene in the family). To actually create amplicons in-silico, you would need to artificially create some VDJC recombinants, and look at where the primers bind in these.
Jake
Hey Jake,
Thanks a lot for your clear explanation. I checked as you said and identified where they bound. However, I have a trouble with another sets of primer from the article of Schanz, M., et al. (2014). High-Throughput Sequencing of Human Immunoglobulin Variable Regions with Subtype Identification. PLoS ONE, 9(11), e111726–9. http://doi.org/10.1371/journal.pone.0111726), they used different primers which they referred Nussenzweig's Science paper (Scheid, J. F., et al. (2011). Sequence and Structural Convergence of Broad and Potent HIV Antibodies That Mimic CD4 Binding. Science, 333(6049), 1633–1637. http://doi.org/10.1126/science.1207227). According to this Science paper, these primers are generated out of FR1 region due to mutation that can occur in that region. Primers were set farther upstream to avoid the mutated region. I found some that are just next two FR1 region but I couldn't find this one for instance: VH1LD - GGTTCCTCTTTGTGGTGGC. You can this from IgBlast too since out of the FR1 region. Any idea how to find this?
Thank you very much.
All the best,
Bahti
Hey Jake,
I think I found it. I just need to check one-by-by the IGHV region of human and do blast to find it. I'd be happy to hear if you have any alternative of course. Thanks for your help.
Best wishes,
Bahti
Hi Bhati,
Yes, the primers in those papers bind to the leader sequence rather than FR1. There are pros and cons of both depending on the application. I think that most people who use FR1 primers do not notice significant issues due to mutation in FR1, as primers/PCR protocols are designed to allow for this. As the leader sequence is untranslated, it is not included in the V gene sequences on IgBlast, so I think your approach is the best way.
Jake
- Badges
- Science topic
- Similar topics
- Computer Science and Engineering
- Bioinformatics
- Bioinformatic Tools