Hello,
Can you tell me please how can i identify in which direction the sequence of DNA will be inserted into the vector (for example pBluescript)
Please look at the attached file below (PBLUESCRIPT MAP)
That depends on how you are inserting it - are you going to use a different restriction site (for sticky ends) on either side of your gene?
Thank you for the reply. I will use a restriction enzyme that cut in one site (PSTI) (Sticky ends) for the orf >lcl|Sequence 1 ORF:156..1232 Frame +3
ATGACAGGAGTAAAAATGGCTATCGACGAAAACAAACAGAAAGCGTTGGCGGCAGCACTGGGCCAGATTG
AGAAACAATTTGGTAAAGGCTCCATCATGCGCCTGGGTGAAGACCGTTCCATGGATGTGGAAACCATCTC
TACCGGTTCGCTTTCACTGGATATCGCGCTTGGGGCAGGTGGTCTGCCGATGGGCCGTATCGTCGAAATC
TACGGACCGGAATCTTCCGGTAAAACCACGCTGACGCTGCAGGTGATCGCCGCAGCGCAGCGTGAAGGTA
AAACCTGTGCGTTTATCGATGCTGAACACGCGCTGGACCCAATCTACGCACGTAAACTGGGCGTCGATAT
CGACAACCTGCTGTGCTCCCAGCCGGACACCGGCGAGCAGGCACTGGAAATCTGTGACGCCCTGGCGCGT
TCTGGCGCAGTAGACGTTATCGTCGTTGACTCCGTGGCGGCACTGACGCCGAAAGCGGAAATCGAAGGCG
AAATCGGCGACTCTCACATGGGCCTTGCGGCACGTATGATGAGCCAGGCGATGCGTAAGCTGGCGGGTAA
CCTGAAGCAGTCCAACACGCTGCTGATCTTCATCAACCAGATCCGTATGAAAATTGGTGTGATGTTCGGT
AACCCGGAAACCACTACCGGTGGTAACGCGCTGAAATTCTACGCCTCTGTTCGTCTCGACATCCGTCGTA
TCGGCGCGGTGAAAGAGGGCGAAAACGTGGTGGGTAGCGAAACCCGCGTGAAAGTGGTGAAGAACAAAAT
CGCTGCGCCGTTTAAACAGGCTGAATTCCAGATCCTCTACGGCGAAGGTATCAACTTCTACGGCGAACTG
GTTGACCTGGGCGTAAAAGAGAAGCTGATCGAGAAAGCAGGCGCGTGGTACAGCTACAAAGGTGAGAAGA
TCGGTCAGGGTAAAGCGAATGCGACTGCCTGGCTGAAAGATAACCCGGAAACCGCGAAAGAGATCGAGAA
GAAAGTACGTGAGTTGCTGCTGAGCAACCCGAACTCAACGCCGGATTTCTCTGTAGATGATAGCGAAGGC
GTAGCAGAAACTAACGAAGATTTTTAA
If you clone between two different restriction sites and prepare your insert with compatible ends (i.e. one end compatible with site 1 and the other end compatible with site 2), then you decide in which direction the insert will be. If instead you clone in only one site (say EcoRI), then you will have to sequence (or do some additional restriction analysis) to determine the orientation of your clone(s).
Thank you. If i choose for example PST I and ECO R I, how can define the direction, is it possible to do this task with a bioinformatic tool ?Can you give me a suggestion of a program or a tool
PstI and EcoRI are too close together and the restriction enzymes need some room to load themselves onto the DNA and cleave. See if you can find two restriction enzymes that are further away from each other (say 12-15 bp) and, if possible, work with the same buffer (check the catalogue). Once you have found that, let me know and we go on with the second step, how to design your insert. Usually pen and paper is all you need.
One more thing ... do you plan to cleave your insert at the PstI site that is at this location?
...GCTGACGCTGCAGGTGATC...
Do you have the insert already or will you synthesize the oligos?
Please checked your vector/inserted seq junction with a simple pcr for two aim 1_insertion 2_correct direction of your insert...
If you have control vector..you can checked your cloning process
Note: restriction enzyme in 5&3 prime end of insert/ligate can show your direction.
If you are using a two different enzymes to clone your insert, it can go only in one direction. But, if you are using a single enzyme to clone, then you can do restriction analysis to know the orientation of your insert. Use two enzymes to cut your clone, one in the insert and the second one on the vector, so that you get two different sizes base on the orientation of the insert
- Badges
- Science topic
- Similar topics
- Biological Science
- Molecular Biology
- Molecular Methods
- Cloning