I am carrying out a cloning project where I have to ligate insert of 954bp to a vector of 8.7kb. I have synthesised the insert with PCR and I had intoduced sites for BamHI and MscI at each ends of the insert corresponding to the MCS of my vector. However I am having problems with the ligation. I am not getting any ligation products. Is there any specific way which I need to follow so that I get the ligation product? I have tried ligating with T4 DNA ligase and quick ligation kit from NEB. I have tried transforming the ligation mixture as well as check it on a gel. On gel I do not see any bands corresponding to the ligated product. And after transformation I do not get higher colonies than the control (vector alone without ligase).
I suggest to do a sequential digestion with BamHI and Msc I. Also load on get and check bit digested product to check if its working properly. I suggest if MscI is slow cutting enzyme. Do a digestion with BamHI for 2 hours and than Msc I overnight. Check for the buffers with 100% activity. Good luck
@Thomas Schwarz
I have purified the PCR products as well as the digested enzymes using the purification kits. I checked the PCR product on gel and I get good yield and the expected band.
And the PCR products does not end with my enzyme sites. I have added 6 bases for my primers at the ends
Primer 1: gcaattcactatttaaggggttttcaaagcca
Primer2:TAAGCAGGATCCTAGttattttaactttgcgttttgacttagccaagcca (BamHI site in bold)
Since MscI is blunt end generating enzyme and the PCR product is blunt ended I did not digest the PCR product with MscI. I used only BamHI.
I have tried one more control just now, a single cut vector with BamHI and ligated the same after with quick ligase according to the protocol of NEB. And I do not see any ligated product (the recircularized vector)on the gel. Does this mean my enzymes are not working?
@Shambhuprasad Thank you for the reply
I did do the sequential digestion, but with MscI first, checked on a gel for complete digestion then digested with BamHI for an hour.
I suggest to try the other way around use BamHI first and then Msc I. Use buffers with 100% activity. I agree with Nikonov to dephosphorylate the vector. If you are trying with the blunt end cloning try to clone with a cut with EcoR V. It generates blunt end products or else use TA cloning kit from Promega. amplify your product with Taq and then try sub cloning to your desired vector. Try you to heat inactivate at 80 degrees for 15-20 minutes after your digestion and try. Good luck
@Nikonov Thank you for the reply
I have not dephosphorylated the vector since the PCR products are not phosphorylated.
How do I check whether the BamHI motif is methylated?
Akshay, do you use a standard Taq polymerase? Taq polymerase adds a 3' "A" overhang so your MscI site is no longer blunt. Try to also digest with MscI and let us know the result
@Navarro
I use Phusion high fidelity polymerase from NEB. It creates blunt end. I will try and digest the insert too like you suggested.
- Badges
- Science topic
- Similar topics
- Biological Science
- Molecular Biology
- Molecular Methods
- Cloning