We performed 4C-seq according to the van de Werken protocol. In order to sequence the 4C libraries produced in Hi-seqX Illumina platform, we need to design long primers with P5 and P7 adaptors, as well as, indexes for paired-end sequencing compatible with nextera. The reading primer that we have selected is in Reverse complement to the DNA sequence and the non-reading primer is in forward. Should I attach a P5 to the reading primer in forward or reverse complement? And regarding the non-reading primer, should I add the P7 in forward or reverse complement? From my point of view, it should be as follows: Reading primer: 3' - specific primer 1 - read sequencing 1 - Index P5 - P5 - 5'                             5'- GTGTAGATCTCGGTGGTCGCCGTATCATT  -  TCTACTCT  -  CTGTCTCTTATACACATCTGACGCTGCCGACGA  -  sepecific primer 1 (reverse complement) -3'

Non reading primer: 5'- P7 - Index P7 -  read sequencing 2 - specific primer 2 - 3' 5´- CAAGCAGAAGACGGCATACGAGAT  -  TTCTGCCT  -  GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG  -  specific primer 2 (forward) -3' Does illumina platform adaptors for P5, P7 and each of their reverse complements in each lane? So that either having P5 and P7 as forward or reverse complement, the sequencing still occurs?

Can anyone help me with this issue?

Thank you for your help.

Cheers,

Celina