Hi there,
I am trying to design allele specific primers for KASP assays to validate the SNPs from GWAS results. However, few of my SNP sequences have two or more SNPs only few base pairs apart and am having trouble designing primers for them.
Please see the example sequence below:
TGCAGATG[T/C]ACAAATTATAAATTATTTGACAAATAGAT[A/-]ATGTTATTTCATATATT
Dear Sir. Gurpreet Singh ,
I think you can use the Tetra-Primers (ARMS)PCR technique, where you can design four specialized primers for each SNP which work efficiently and inexpensively, but you need to optimization steps for each set of four primers for each SNP.
Primer design for tetra-primer ARMS-PCR link is
http://primer1.soton.ac.uk/primer1.html
I hope this is useful for you.
Best wishes.
Hi. You can design two primers sets each one with a SNP (region is long enough). The the magic is on doing gradients PCRs to find the optimal binding temperature that allow you to identify SNPs. So it is very important that you have the proper controls.
Dear Sir. Gurpreet Singh ,
I think you can use the Tetra-Primers (ARMS)PCR technique, where you can design four specialized primers for each SNP which work efficiently and inexpensively, but you need to optimization steps for each set of four primers for each SNP.
Primer design for tetra-primer ARMS-PCR link is
http://primer1.soton.ac.uk/primer1.html
I hope this is useful for you.
Best wishes.
There are a few other ways to tackle this question (how to differentiate SNPs in allelic variants):
Just sequence them with Sanger (cheap and easy, but a lot of staring at chromatograms)
dCAPS style primers and restriction digest (annoying, but it works; lots of time staring at gels) see attached paper
You can design short primers and use a high-resolution melt-curve to genotype (takes a bit to optimize, but super quick once you get it working).
If I had
- Badges
- Science method