How can I confirm the correct insertion of sgRNA into pX459 vector?

More Diego Benitez Riquelme's questions See All

Which statistical test to use for comparing percentages between multiple groups?

Hello everyone! I am looking for some statistical help! I am working in in vitro micropropagation and one of the aspects that I am studying is the rooting of plants in 10 different growing media....

14 January 2021 7,575 5 View

QUANTUM INFORMATION: Why a Toffoli gate can be used to obtain any permutation gate?

Hi, i am sudying some quantum computer science and I am really struggling to find an explanation to the question done above. Any kind of help would be wonderfull. Greets.

09 November 2020 4,657 3 View

Is there a valid alternative way to replace the use of camera lucida (or drawing tube) for scientific and taxonomic drawings?

So far I have not been able to find a camera lucida that fits a low range microscope.

05 September 2020 3,342 4 View

How to obtain Uranium metal from Uranyl Nitrate?

I got some Uranyl Nitrate crystals and want to get Uranium metal, to start, think I can use heating to decompose the nitrate salt in order to get the oxide, and then I should reduce the oxide to...

22 August 2020 525 3 View

Why is my bacteria not growing after a transformation?

Hello, I did a transformation a few weeks ago and while only a few bacteria grew, I was able to pick single colonies for a liquid culture. However, I had to repeat this experiment because...

28 July 2020 278 6 View

How to use Mixed Model ANOVA for non-normal data?

My design is that of repeated measures (within-subject design). That is, the subjects (name) are the same through the groups (group). This implies that there is dependency between the data, which...

18 July 2020 2,731 12 View

Is it possible to obtain a product similar to composting from organic waste in 24 hours?

We are working on the mathematical modeling of the decomposition of organic residues for the realization of a reactor of a product similar to composting in approximately 24 to 48 hours, although...

16 July 2020 2,697 16 View

Is it possible to compost in 24 hours?

We are working on the mathematical modeling of composting for the realization of a composting reactor in approximately 24 to 48 hours, although first I would like to know if it is feasible and if...

14 July 2020 1,838 7 View

Is there a mathematical model that describes the composting process?

These models can be of the different stages of composting, either from the thermophilic or mesophilic stage. Thanks

22 June 2020 3,462 6 View

How do I know if my GLM using selection of models by Akaike Information Criterion is ok?

I'm trying to see the isolated and combined effects of precipitation and three different human disturbances indexes are having an effect on the growth of a cactus. I have a gradient of eight...

16 May 2020 5,868 5 View

How can I completely delete a protein on the genomic level using Crispr?

I want to completely delete or largely truncate a gene and not only achieve a functional knockout in a cell line. I can only transfect my cells with the Crispr/Cas9 sgRNA RNP and not introduce a...

08 February 2021 2,032 2 View

Does gene insertion via CRISPR/Cas9 result in chromosomal abnormalities?

Hello, I hope to insert a gene into mammalian cells in culture using CRISPR/Cas9 and an HDR template. Will insertion of a 1 kilobase gene cause chromosomal abnormalities and effect cell...

31 January 2021 2,516 1 View

Do I need to add a start codon and stop codon for the sgRNA expression in crispr?

Dear All, I am now designing the sgRNA for knocking out the gene through crispr. Base on my learning experience, a start codon and a stop codon should be put in the N terminus and the C terminus...

16 December 2020 5,795 3 View

How big can a enhancer deletion be ? how can we obtain homologous deletion clone ?

Hi all, I have tried to use Crispr Cas9 ( plasmid px333_cas9_mCherry) to delete some enhancers. I designed sgRNA using Chopchop website to target both sides of an enhancer to induce homologous...

13 December 2020 942 3 View

Where can I find off targets for Apis mellifera?

I would like to find off target sites for my sgRNA, however the more commonly used off target finders do not include apis meliifera, is there an application or website that would allow me to do...

09 November 2020 3,463 1 View

Why do I get a lot of colonies upon transformation of digested lenti guide puro?

I digested my lenti guide puro plasmid. The only modification in this plasmid is that it has blasticidin resistance gene instead of puromycin. I get the desired bands at ~8kb but I do not see the...

03 August 2020 2,854 4 View

Does this cold spring harbor protocol really edit circular dna with pcr?

Hello - I am studying this protocol which claims to use pcr to clone in/replace a small piece of an sgrna plasmid with a new guide sequence provided by an oligo with homology to the sgrna...

02 March 2020 6,358 2 View

Opinions on using PCR to re-target plasmid sgrna, with a "universal" sgrna scaffold?

I am using the following protocol from a CSH lab manual edited by Doudna on CRISPR, to attempt to retarget sgrna scaffold in a plasmid. but....I get DNA stuck in the well, not migrating....

01 February 2020 6,327 3 View

How do I rank CRISPR sgRNA pairs by on-target activity?

I am currently trying to generate CRISPR sgRNA pairs with Sanger Institute's online genome-editing tool. I enter the sequence of interest and it generates hundreds of sgRNA pairs, which I can rank...

09 October 2019 4,289 2 View

Multiple sgRNA cloning into pX333 plasmid using BsaI and BbsI restriction enzyme site?

Currently, I am using a plasmid containing two gRNA cloning site. The restriction enzymes used for cloning gRNAs into this plasmid, pX333, are BsaI and BbsI. I digested the pX333 plasmid using...

09 October 2019 2,743 6 View

Diego Benitez Riquelme

Thank you very much yannick!

I am going to use the U6-Fwd Primer.

Vielen Dank!

Ümit Uzun

Dear Diego,

I agree Yannick, you prefer U6-Fwd primer for confirm the correct insertion or you can choose optional sequance the Cas9 gene by using the CBh-Fwd and SXRP007 primers (Ran et al., 2013) TTTATGGCGAGGCGGCGG, GTGTGAAAGAGCTGCTGGGGATCAC respectively.

Regards,

Ümit.