How can I calculate concentration with PLS regression?

More Fateme Khoshtarash's questions See All

Is this a facetotecta nauplius?

This larva was captured using a plankton net in the Persian Gulf during the summer. I believe it may be a Facetotecta nauplius.

08 August 2024 3,746 4 View

How to use CINPE4 elements in ABAQUS for infinite boundaries?

Hi All, I have used infinite elements in Abaqus to absorb waves at the sides and bottom boundaries of the soil domain. but the boundary reflected wave can not be completely absorbed on the...

06 June 2024 448 4 View

How merge output files of simulation with NAMD?

I have been running steered molecular simulation with NAMD, but in the middle of my simulation it has stopped and i have restarted from specific steps which had stopped. Finally i have two parts...

19 May 2024 1,483 2 View

What is the reason of pattern of lithography in center of wafer are thicker in comparison of edges of the wafer?

Hello When we pattern a mask in a wafer, after exposure we noticed that the length of our patterns in the center of our wafer is thicker in copmarison with edges of it. What is the reason and...

22 April 2024 6,796 4 View

Why exon number change by zooming out in Genome Browser?

Why does the number of exons of PTPRQ change by zooming out in Genome Browser site? the NM number is: NM_001145026.2

21 April 2024 8,336 1 View

No matches result in silico PCR at Genome Browser webpage!?

I want to check my designed primers by in silico PCR in Genome Browser. but always face with this message [ No matches to cagatgagtcagtgccgttag agtaggtgctgactggttcc in Human Feb. 2009...

06 April 2024 3,951 4 View

What is the role of surface tuxture in anti gravel coatings?

Anti gravel or stone chip resistant coatings are often defined as textured coatings. Does the tuxtured surface play a role in the coating performance, especially in anti gravel properties?

22 March 2024 7,758 0 View

Have you ever run a steered molecular dynamic simulation with NAMD?

Hi everyone. Is there anybody here who have run a steered molecular dynamic simulation with NAMD and knows about the parameters which i have to write in my configuration file?

05 March 2024 7,935 1 View

How can the bitter taste from calcium chloride treatment in a protein product be minimized while maintaining the desired texture?

Greetings esteemed colleagues, I am currently working on my master's thesis, focusing on a protein product that requires the use of calcium chloride treatment in one of its stages to form calcium...

24 February 2024 1,806 2 View

How could i minimize and equilibrate system with available output files of CHARMM-GUI for NAMD?

I have downloaded output files of CHARMM-GUI for NAMD which i had made membrane-protein complex with CHARMM-GUI and now i don't know what should i do with these files before running simulation...

13 February 2024 4,182 0 View

GC-MS retention index prediticon?

Hello experts, Does anyone know any free software about retention index prediction ?

08 August 2024 7,403 2 View

Is there an alternative to a multinomial regression which allows the DV to be non mutually exclusive?

I am trying to analyse data from a survey examining what variables affect teachers perceived barriers to incorporating technology into their classroom. I have 5 predictor variables however my DV...

06 August 2024 1,752 3 View

In order to run Multinomial Logistic Regression, is it required that the data be in the long format?

I am using unit level data (IHDS round 2) & Stata 17

06 August 2024 5,725 2 View

Why do we equate male and female arousal?

Women, on the other hand, can become physically aroused (increased blood flow in the reproductive organs) without becoming psychologically aroused even in the slightest. (Robert Weiss)

05 August 2024 9,537 2 View

I need the datasets of Microgrid for system identification?

Hi I am working on data driven model of the microgrid, for that, i need the reliable datasets for the identification of MG data driven Model. Thanks

02 August 2024 5,748 4 View

Should I remove an item from a scale to raise Cronbach's alpha and McDonald's omega or is it better to leave it if they are both over .7 already?

Hello! I have this scale which had 10 items initially. I had to remove items 8 and 10 because they correlated negatively with the scale, and then I removed item 9 because Cronbach's alpha and...

01 August 2024 4,606 7 View

Talking therapies for bipolar, psychology?

what is the best research evidence for psychological interventions for Bipolar?

01 August 2024 6,023 2 View

Normality assumption for linear regression is The assumption of normality is whether for residual errors or predictor variavble?

When we conduct linear regression, there are several assumptions. The assumption of normality is whether the residual errors are normally distributed, not whether a predictor is normal?

31 July 2024 6,164 3 View

What are some diseases that are caused by overactivity of enzymes?

I want to choose a resarch topic regarding enzyme inhibition. So I did my research and found out most of the diseases that originate from enzymes were actually caused by the "deficiency" of...

30 July 2024 2,483 5 View

Recruitment for Postpartum Mental Health Research?

We are currently recruiting for two studies on postpartum mental health as part of our work at the Perinatal Mental Health Research Lab at Alliant International University. If you or someone you...

30 July 2024 2,950 0 View

Anuraj Nayarisseri

If interested to do PLS regression in R or Python, pls let me know.

Fateme Khoshtarash

Anuraj Nayarisseri Python or MATLAB is ok

Fateme Khoshtarash for PLS using python, pls follow this https://www.kaggle.com/code/phamvanvung/partial-least-squares-regression-in-python

If you need any technical help, pls let me know.

Best !!