How can I break the bond between aminoacids and Gold Nanoparticles?

More Fateme Salimian's questions See All

Is this a facetotecta nauplius?

This larva was captured using a plankton net in the Persian Gulf during the summer. I believe it may be a Facetotecta nauplius.

08 August 2024 3,746 4 View

How to use CINPE4 elements in ABAQUS for infinite boundaries?

Hi All, I have used infinite elements in Abaqus to absorb waves at the sides and bottom boundaries of the soil domain. but the boundary reflected wave can not be completely absorbed on the...

06 June 2024 448 4 View

How merge output files of simulation with NAMD?

I have been running steered molecular simulation with NAMD, but in the middle of my simulation it has stopped and i have restarted from specific steps which had stopped. Finally i have two parts...

19 May 2024 1,483 2 View

What is the reason of pattern of lithography in center of wafer are thicker in comparison of edges of the wafer?

Hello When we pattern a mask in a wafer, after exposure we noticed that the length of our patterns in the center of our wafer is thicker in copmarison with edges of it. What is the reason and...

22 April 2024 6,796 4 View

Why exon number change by zooming out in Genome Browser?

Why does the number of exons of PTPRQ change by zooming out in Genome Browser site? the NM number is: NM_001145026.2

21 April 2024 8,336 1 View

No matches result in silico PCR at Genome Browser webpage!?

I want to check my designed primers by in silico PCR in Genome Browser. but always face with this message [ No matches to cagatgagtcagtgccgttag agtaggtgctgactggttcc in Human Feb. 2009...

06 April 2024 3,951 4 View

What is the role of surface tuxture in anti gravel coatings?

Anti gravel or stone chip resistant coatings are often defined as textured coatings. Does the tuxtured surface play a role in the coating performance, especially in anti gravel properties?

22 March 2024 7,758 0 View

Have you ever run a steered molecular dynamic simulation with NAMD?

Hi everyone. Is there anybody here who have run a steered molecular dynamic simulation with NAMD and knows about the parameters which i have to write in my configuration file?

05 March 2024 7,935 1 View

How can the bitter taste from calcium chloride treatment in a protein product be minimized while maintaining the desired texture?

Greetings esteemed colleagues, I am currently working on my master's thesis, focusing on a protein product that requires the use of calcium chloride treatment in one of its stages to form calcium...

24 February 2024 1,806 2 View

How could i minimize and equilibrate system with available output files of CHARMM-GUI for NAMD?

I have downloaded output files of CHARMM-GUI for NAMD which i had made membrane-protein complex with CHARMM-GUI and now i don't know what should i do with these files before running simulation...

13 February 2024 4,182 0 View

Hello researchers Is this a random laser or just fluorescence?

I am using Rhodamine6G as gain medium and silver nanoparticles as scatterers on a microscope slide and laser input 532 nm comes from above.

09 August 2024 9,894 2 View

How to prepare the nanoparticle treated fungal sample for Environmental SEM analysis?

A fungal strain was treated with nanoparticles. We want to do an environmental SEM analysis. So could anyone share your views on preparing the sample? Thank you.

07 August 2024 5,307 1 View

Separation of organic acids-HPLC?

Hello What should be done to separate and identify organic acids in HPC when their RetTime is the same?Like oxalic acid with Propanoic Acid.or acids that have a very close RetTime.

07 August 2024 8,782 3 View

Why does my protein refolded to beta sheet during thermal denaturation analysis?

Hi! So i attempted to understand a novel protein behavior towards heat application by analyzing its secondary structure change. I subjected the protein to a thermal denaturation analysis using...

06 August 2024 1,989 3 View

Weak DAPI staining after immunohistochemistry - how to improve?

After immunohistochemistry of previously fixed in PFA and EtOH and then frozen 20 μm sections of zebrafish brain, DAPI staining is very weak (right) compared to the same sections stained without...

05 August 2024 9,637 2 View

Determining the worth of a point improvement in Hamilton Depression Scale?

Dear readers, Thanks for your attention. I am wondering about the health economic problem of quantifying the value of interventions which a) prevent, b) improve symptom profile and c) ultimately...

05 August 2024 3,246 1 View

Low-yield gel extraction problem?

I am having an issue with my gel image where my PCR product is not appearing very bright on the gel. When I perform gel extraction, the A260/280 purity value is very low. I used the Qiagen gel...

05 August 2024 9,798 3 View

How to isolate lymphocytes from mouse spleen?

I have tried several times to isolate lymphocytes from mouse spleen, but all attempts have been unsuccessful. I tried most available protocols. I used different dissociation media (HBSS with Ca...

04 August 2024 9,913 7 View

Binder for ZnO nanoparticles in graphite paste electrode?

I have been using paraffin, but the deposited ZnO still detach from electrode. What is the best binder to modify graphite paste electrode with ZnO nanoparticles?

03 August 2024 4,624 3 View

Can i quantify a nanoparticle encapsulated in cell culture medium by hplc?

Hello, if you made a transwell assay where you incubate the cells with a nanoparticle-encapsulated drug and considering that in the oposite compartment you'll have both the free and encapsulte...

03 August 2024 2,730 1 View

George Tsekenis

When you say amino acids, you mean any in specific or do you refer to proteins?

Fateme Salimian

No, They are free amino acids in Biological samples specially Methionine and Cysteine.

This earlier post that I have come across might be of help to you. Sonication or a reducing agent will usually do the job.

https://www.researchgate.net/post/How_can_one_break_a_gold-thiol_bond

Thanks Dr. George

Salimeh Ghorbani

your wellcome