Hi All,
I am trying to amplify mitochondrial 16S gene for marine snails (Calliostomatidae) and other vetigastropods, but I only get primer dimers or nothing on the gel. These primers have worked previously in my lab and in numerous other publications. The DNA concentrations are low, but they have amplified for COX1 using the Folmer universal primers.
I am using the Palumbi 16S universal primers (Forward: CGCCTGTTTATCAAAAACAT and Reverse: CCGGTCTGAACTCAGATCACGT). We bought new primers in December 2023. I resuspended them and have tried multiple aliquots. I've tried gradients 45-55 and 55-65 and a touchdown PCR starting at 59 (-1 C/cycle for 10 cycles) and final annealing at 48 for 20 cycles. I've tried the standard, ammonium, and combination 10x buffers. All reagents are from Apex (not a hot start taq), except for the dNTPs.
Our usual protocol is: 2.5 uL of 10x standard buffer, 1.25 uL of MgCl2 (50mM), 0.5 uL of dNTPs (10mM), 1 uL of both primers (10uM), 0.2 uL of taq (5 units), and 2 uL of DNA. This does work for Folmer. Denaturation at 95 C for 4 min, 35 cycles of 95C for 30 seconds, 50C for 30 seconds, and 72C for 30 seconds, and final extension at 72 for 10 min.
I'm desperate and would love to hear any suggestions/tips on how to fix this!! I also unsuccessfully tried ethanol precipitation to increase the DNA concentrations, so tips on that would be appreciated too. Thank you
May simply be low copy number - Have you tried increasing the number of cycles? As long as you dont see amplification in your negative control, it should be fine.
I haven't tried more than 35 cycles. Would you recommend increasing to 40 cycles? Péter Gyarmati
Dear Tiffany
I checked in Primer BLAST. Primers can indeed amplify the snails. See first two results:
Products on target templates
>MF979281.1 Calliostoma unicum isolate DYLKL2 16S ribosomal RNA gene, partial sequence; mitochondrial
product length = 586 Forward primer 1 CGCCTGTTTATCAAAAACAT 20 Template 1 .................... 20 Reverse primer 1 CCGGTCTGAACTCAGATCACGT 22 Template 586 ...................... 565
>NC_068865.1 Tristichotrochus unicus mitochondrion, complete genome
product length = 585 Forward primer 1 CGCCTGTTTATCAAAAACAT 20 Template 10736 .................... 10717 Reverse primer 1 CCGGTCTGAACTCAGATCACGT 22 Template 10152 ...................T.. 10173
But Tm is 52 and 62 for fp and rp by primer blast and 59 and 68 by Thermofisher's online multiple primer analyzer.
Additionally, not a cross dimer but the forward primer forms dimer very easily (Thermofishers online multiple primer analyzer).
See the results:
1 dimer for: f
5-cgcctgtttatcaaaaacat->
||||| | | |||||
Hi Divya Rana
Thank you so much for your responses!! It is insightful and I will definitely try your suggestions again. Yes, I noticed that he responds to a lot of these questions!
Thanks again!!
- Badges
- Science topic
- Similar topics
- Biological Science
- Biochemistry
- Biochemical Techniques
- Analytical Chemistry
- pH