I synthesized single-stranded RNA (~50 nt) containing complementary terminal sequence using T7 in vitro transcription and am wondering whether it folds correctly after purification (in water).
Thanks!
Hello Leonard. You must first consider your method of purification. If you are doing a native purification, your RNA should not be in water only. You should certainly use a buffer near neutral with a combination of monovalent and divalent cations. A good starting point is ~150mM monovalent and 1mM divalent (Mg2+). Most purification techniques will require a refolding protocol similar to what was suggested by Wei. However, RNAs generally fold best in a buffer such as the one suggested for native preps. Also, you should use Mg2+ during folding to stabilize tertiary or even some secondary structure motifs. DO NOT add Mg2+ before heating the RNA as this will degrade the RNA. Allow your sample to cool to < 60C before adding Mg2+ to your sample. Getting correct RNA folding conditions can be tricky and require much trial and error. In many cases it is difficult to determine if your sample is "correctly" folded in a biological sense. A good idea would be to run a gel or size exclusion chromatography under native buffer conditions to determine if your RNA is folding homogeneously. Good luck and let me know if you have any questions or want anything further clarified.
I column purify and store in TE buffer, its more stable, but I would imagine it folds in either TE or water. You can denature by heating up your sample or if running on a gel use denaturing conditions.
If you want your RNA/DNA to fold correctly, you most likely need to dissolve it in some buffer like TE, instead of pure water. Because salt concentration affects the melting temperature of oligonuleotides.
Before you assay the RNA, heat it up to about 75C (you may adjust this temperature depending on the actual Tm of your RNA, most of the time I found 75C is sufficient) for 3 minutes, then let it slowly cool down at room temperature. This can usually assure that your oligos fold correctly. If you instead want to minimize the secondary structure, heat it up and snap cool on ice.
Hello Leonard. You must first consider your method of purification. If you are doing a native purification, your RNA should not be in water only. You should certainly use a buffer near neutral with a combination of monovalent and divalent cations. A good starting point is ~150mM monovalent and 1mM divalent (Mg2+). Most purification techniques will require a refolding protocol similar to what was suggested by Wei. However, RNAs generally fold best in a buffer such as the one suggested for native preps. Also, you should use Mg2+ during folding to stabilize tertiary or even some secondary structure motifs. DO NOT add Mg2+ before heating the RNA as this will degrade the RNA. Allow your sample to cool to < 60C before adding Mg2+ to your sample. Getting correct RNA folding conditions can be tricky and require much trial and error. In many cases it is difficult to determine if your sample is "correctly" folded in a biological sense. A good idea would be to run a gel or size exclusion chromatography under native buffer conditions to determine if your RNA is folding homogeneously. Good luck and let me know if you have any questions or want anything further clarified.
It doesn't matter if your RNA is in water or buffer because each time you are using it you have to denaturate/renaturate it like William or Wei said.
Thank you all for the helpful answers!! One more question:
If I use this RNA for transfection of mammalian cells, do I need to denature/refold it every time? I do believe that RNA will fold automatically-correctly or incorrectly?-after delivering into the cells.
If you want to simply detect protein translated from this RNA I think that it is not necessary to denature/refold it.
Hi David,
Thank you so much for the great mind. As you mentioned the intermolecular base-pairing issue, my actual RNA sequence is GGUAGAAACAAGGGUACAAGAUACCCUGCUUUUGCC, which is predicted to form a ~16 bp partially complementary region with a 5 nt loop. I'm not sure whether the RNA dimer formation may interfere with the specificity of in vitro transcription though (may get byproducts longer than expected size?). And speaking of diluting RNA conc. out, can I have a rough idea of how diluted (nM?) it should be?
- Badges
- Science method
- Similar topics
- Biological Science
- Genetics
- Genetic Analysis
- genetic techniques
- Sequencing