I am seaqrching for a tool that can align exon and intron sequences to a template DNA sequence without disrupting any of the short sequences. I remember that DNAStar was able to do this. Does anyone know if and how this can be done with BioEdit? Or does anyone know of a freeware tool that can do this? Thanks
Carl-Ulrich Zimmerman - Are you asking that if you have sequences containing both exons and introns aka pre-mRNAs then can you align these to a cDNA? Or perhaps to a transcriptome or genome assembly??
Or are you asking that if you have short sequence reads which may contain reads spanning intron/exon boundaries then can these be aligned to a cDNA or transcriptome?
Your question is ambiguous and an appropriate solution would depend on what it is that you are trying to achieve.
For instance Blast as suggested by Paul Rutland will not handle long deletions/insertions (query sequence isoforms?) as well as the UCSC Blat does. If long insertions/deletions are not present then Blast offers better recall and precision than Blat. If there are many query sequences then throughput will become a concern with both tools although Blat is much faster than Blast.
If you are working with NGS readsets then forget Blast and Blat!
If you could elaborate further on the readsets/datasets you have available and what your experimental objectives are then I may be able to offer some more specific advice.
Hi Stuart,
thanks for your reply. What I am trying to achieve is actually not so sophisticated. I would like to visualize the locations of either exons or introns or both on a strech of genomic DNA, using the genomic DNA as a consensus sequence.
e.g.
ATCGGGTAGCCTCAGTACGATAGTAGCAGATCCAGATCAGATCAGATCATTGCATAT
ATCGGGTAGCCT
_________________CAGTACGATAGTAGCAGATCCAGATCAGAT
___________________________________________________________CAGATCATTGCATAT
or see attached pDRAW32 screenshot (except, I would like to see it as aligned sequence data, not as a schematic illustration)
BioEdit can align sequences like this, however, only two at a time. If you try to align more than one sequence, the program disrupts the sequences. What I am trying to do is visualize or select primers from different regions.
- Badges
- Science method