Hi! I'm starting to standardize the PCR, so I'm not really sure wich is the best DNA concentration or primers concentration that I need to use
Mzia 1(5' GATATTTGIGGIGTTCAGCCIATGA 3')
Mzia 2(5' CGCGGTTGATTTCCAGCATGATTTC 3')
According publish papers:
Initial denaturalization: 94 ºC x 1.5 min, 94ºC x 45sec
annealing: 45ºC, 50ºC, 55ºC, 60ºC x 1min
extension: 72ºC x 45 sec (30cycles)
final extension: 72 ºC x 1 min
Hei Paul,
Emplifying g23 sequences may be very tricky according to the origin of your samples. In our case of deep-sea marine samples, it was extremely hard to extract sufficient amount of DNA and therefore really tried to optimize the PCR.
From our experience, which is not mandatory true for everybody:
For every sample we ran 5* reactiosn of 50µL. No results were observed if proofreading polymerase was used, so stick to basic pol. Use BSA, and DMSO in the master mix (1.5µL of each in 50µL MM).
Program:
original temperature and time depends also on your polymerase, we used Takara.
95C. > 5min
95C > 45s
50C (thanks to the DMSO), > 45s
72 > 1 min
72 > 7min
The amount of cycles depends on your goal. We went on with a second PCR for 454 sequencing, and we were not willing any other bands to appear. Therefore we stopped at 20 cycles. You can probably go higher, just try.
Hope this will help!
Cheers.
Hahaha, I am still not a doctor... soon.... :)
Few extra infos:
For a 50µL reaction:
> 0,25µL pol (but this depends on your taq).I think our one has 5u/µL.
> buffer, depends on your buffer concentration too.
> 1,5µL BSA 2%,
> 1,5µL 100% DMSO.
> 4µL of 2.5mM dNTPs
> 5µL of 2.5µM primers (*2)
> for you DNA template, just try different dilution. My DNA concentrations could hardly be measured, and 1 to 3µL per reaction were enough.
I think that should help you. Good luck!
Hei Paul,
Well, 0,25µL is small, but if you do a Master mix for several reactions you ll get into normal pipetting volumes.
Sorry, my bad. 2.5pM... µ looks like p when written quickly on tubes... and I wrote without thinking. I do not exactly know why the colleagues who designed the protocol did not use lower volumes of 100pM primers, as it is often the case...
- Badges
- Science topic
- Similar topics
- Biological Science
- Microbiology
- Virology