1 pepc/c4-0f ccgmggmsckccatggcgtc
2 pepc/c4-3200r atgccaagattttccacttggac
Marjan,
m means a or c
s means c or g
k means g or t
You can design a primer mix where you can get half of the primer in the solution with an A or C etc.
You can check this website for the codes:
http://www.boekhoff.info/?pid=data&dat=fasta-codes
Best
Ijad
Dear Marjan
Those primers can be called as Degenerate primers which can amplify more then one gene of same family or different family.
@ Liad: Thanks for useful link, is it possible to explain more pricise, How can I get half of primer in the solution with A or C?
For comparing in fasta format for allignment which sequence should we input?I mean for examlpe:K or g/t?
@ Gael Thanks many useful
Dear allI have 7 formative constructs with 63 items and every constucts has 9 indicators.I run my data for PLS.I need to taste heterogeneity for the pre-test.Is any specific test for that? I...
01 February 2015 7,266 4 View
I listed events from which samples of a study were taken. I do not know the whole population. I participated in all of them during 6 months and I gave the questionnaire to all of the people who...
04 May 2014 4,192 13 View
As I know and read in books, we cannot use the non probability method for inferential analysis. We can only use descriptive statistics for non-probability sampling. Do you know any thesis or...
04 May 2014 3,541 45 View
For testing reliability/statistic work on data, all the questions for every construct (for example attitude) should be in the same direction in terms of being agree or disagree? If the questions...
10 November 2013 5,760 5 View
I designed a primer with high Tm temperature (74, 70) [I could not find a better primer. In addition, before PCR, I have to do RT-PCR to convert RNA to c DNA] 1. What kind of PCR do you suggest...
09 October 2011 3,283 5 View
Back ground: I decide to transfer Gene related to Saccharum officinarum into the other plant and then express. Then I just need ORF .I should design the primer for the first step after extracting...
09 October 2011 3,350 12 View
09 October 2011 5,633 3 View
09 October 2011 7,745 1 View
What factors are important for editing?
08 September 2011 2,837 3 View
How manually editing multiple alignment? What factors are important for editing?
08 September 2011 1,582 4 View
Would you please let me to know about the methods for measurement of medullation and Kemp % on animal? My problem is that the wool sampling and sending to laboratory is not possible. So I would...
21 February 2021 7,260 4 View
Hi all, I have generated two gene expression curves by measuring bioluminescence every 10 mins for 12 hrs. These curves tend to overlap at at some time points, while a difference can be seen at...
02 February 2021 2,613 7 View
Dear Colleagues, I am new to genes and genotyping and I need help. I am trying to figure our how AA, AG, and GG genotypes map on to A1 for DRD2/ANKK1 Taq1A polymorphism(rs1800497) and Val or MET...
02 February 2021 3,861 3 View
I made a new bacterial strain with an unmarked deletion using 2 step homologous recombination (with sacB counterselection). The full protocol is given in the link at the bottom. The protocol...
01 January 2021 1,580 4 View
I am doing semantic analysis of science and grey literature publications in the field of plant genetics and breeding. I have a standard dictionary but I am not sure if it captures the state of art...
31 December 2020 5,871 4 View
In my personal experience I have find the higher rate of sprouting when fresh cow dung is applied on the top side of cutting what might be its reason.
24 December 2020 4,068 6 View
Do you think the plant can communicate with each other, what is the level of feeling in plants?
22 December 2020 2,754 17 View
18 December 2020 6,908 3 View
It is generally seen light coloured varieties has more storage life.what's relation with colour and size with storage life.
13 December 2020 634 18 View
I am usiing LAMP kit, specifically designed for liriomyza huidobrensis. I have a random samples of differet insects and LAMP seems to amplify insects from other Genus as well. Although, other...
07 December 2020 5,630 3 View