Is checking heterogeneity necessary for pre-test?

Dear allI have 7 formative constructs with 63 items and every constucts has 9 indicators.I run my data for PLS.I need to taste heterogeneity for the pre-test.Is any specific test for that? I...

01 February 2015 7,266 4 View

What is the sampling method for my quantitative survey?

I listed events from which samples of a study were taken. I do not know the whole population. I participated in all of them during 6 months and I gave the questionnaire to all of the people who...

04 May 2014 4,192 13 View

Can anyone help with non probability sampling?

As I know and read in books, we cannot use the non probability method for inferential analysis. We can only use descriptive statistics for non-probability sampling. Do you know any thesis or...

04 May 2014 3,541 45 View

Direction of questions in questionnaire?

For testing reliability/statistic work on data, all the questions for every construct (for example attitude) should be in the same direction in terms of being agree or disagree? If the questions...

10 November 2013 5,760 5 View

primers with high Tm temperature

I designed a primer with high Tm temperature (74, 70) [I could not find a better primer. In addition, before PCR, I have to do RT-PCR to convert RNA to c DNA] 1. What kind of PCR do you suggest...

09 October 2011 3,283 5 View

Some problems related to design primer:

Back ground: I decide to transfer Gene related to Saccharum officinarum into the other plant and then express. Then I just need ORF .I should design the primer for the first step after extracting...

09 October 2011 3,350 12 View

Some problems related to design primer for the gene of intrest:

Back ground: I decide to transfer Gene related to Saccharum officinarum into the other plant and then express. Then I just need ORF .I should design the primer for the first step after extracting...

09 October 2011 5,633 3 View

The primers with high TM temprature

I designed a primer with high Tm temperature (74, 70) [I could not find a better primer. In addition, before PCR, I have to do RT-PCR to convert RNA to c DNA] 1. What kind of PCR do you suggest...

09 October 2011 7,745 1 View

Multiple alignment, Important Factors in alignment:

How manually editing multiple alignment? What factors are important for editing?

08 September 2011 1,582 4 View

Dear all. I got this primer from article (Besnard, 2003); I do not know what are M,S and K?

1 pepc/c4-0f ccgmggmsckccatggcgtc 2 pepc/c4-3200r atgccaagattttccacttggac

08 September 2011 2,879 5 View

How we can measure Kemp % in wool without using of benzene?

Would you please let me to know about the methods for measurement of medullation and Kemp % on animal? My problem is that the wool sampling and sending to laboratory is not possible. So I would...

21 February 2021 7,260 4 View

Statistical methods for comparing gene expression curves?

Hi all, I have generated two gene expression curves by measuring bioluminescence every 10 mins for 12 hrs. These curves tend to overlap at at some time points, while a difference can be seen at...

02 February 2021 2,613 7 View

Help needed: How to map AA, AG, and GG genotypes on to polymorphism information?

Dear Colleagues, I am new to genes and genotyping and I need help. I am trying to figure our how AA, AG, and GG genotypes map on to A1 for DRD2/ANKK1 Taq1A polymorphism(rs1800497) and Val or MET...

02 February 2021 3,861 3 View

New knockout bacterial strain: Can't electroporate it?

I made a new bacterial strain with an unmarked deletion using 2 step homologous recombination (with sacB counterselection). The full protocol is given in the link at the bottom. The protocol...

01 January 2021 1,580 4 View

Can you advise reference publications/standards on characterizing plant genetics research and development activities, and the outputs it generates?

I am doing semantic analysis of science and grey literature publications in the field of plant genetics and breeding. I have a standard dictionary but I am not sure if it captures the state of art...

31 December 2020 5,871 4 View

What is the role of fresh cow dung in sprouting in stem cutting propagation?

In my personal experience I have find the higher rate of sprouting when fresh cow dung is applied on the top side of cutting what might be its reason.

24 December 2020 4,068 6 View

What is the level of consciousness , communication and feeling in plants ?

Do you think the plant can communicate with each other, what is the level of feeling in plants?

22 December 2020 2,754 17 View

How to cut dsDNA chain with Uracil-DNA Glycosylase at the point of dU in room temperature?

18 December 2020 6,908 3 View

Why pink coloured or light red onion have more storage life than white and dark red one and smaller size one to has more than bigger one?

It is generally seen light coloured varieties has more storage life.what's relation with colour and size with storage life.

13 December 2020 634 18 View

Can LAMP distinguish the species from different genus/family?

I am usiing LAMP kit, specifically designed for liriomyza huidobrensis. I have a random samples of differet insects and LAMP seems to amplify insects from other Genus as well. Although, other...

07 December 2020 5,630 3 View