What factors are important for editing?
Hi, You can try the software Bioedit a free software available on line... Regards!
Yes, Bioedit is really great. If you have access to it, you can use Seqman from the LaserGene suite. This software allow also to display chromatograms.
Dear allI have 7 formative constructs with 63 items and every constucts has 9 indicators.I run my data for PLS.I need to taste heterogeneity for the pre-test.Is any specific test for that? I...
01 February 2015 7,308 4 View
I listed events from which samples of a study were taken. I do not know the whole population. I participated in all of them during 6 months and I gave the questionnaire to all of the people who...
04 May 2014 4,254 13 View
As I know and read in books, we cannot use the non probability method for inferential analysis. We can only use descriptive statistics for non-probability sampling. Do you know any thesis or...
04 May 2014 3,603 45 View
For testing reliability/statistic work on data, all the questions for every construct (for example attitude) should be in the same direction in terms of being agree or disagree? If the questions...
10 November 2013 5,840 5 View
I designed a primer with high Tm temperature (74, 70) [I could not find a better primer. In addition, before PCR, I have to do RT-PCR to convert RNA to c DNA] 1. What kind of PCR do you suggest...
09 October 2011 3,331 5 View
Back ground: I decide to transfer Gene related to Saccharum officinarum into the other plant and then express. Then I just need ORF .I should design the primer for the first step after extracting...
09 October 2011 3,396 12 View
09 October 2011 5,685 3 View
09 October 2011 7,801 1 View
How manually editing multiple alignment? What factors are important for editing?
08 September 2011 1,622 4 View
1 pepc/c4-0f ccgmggmsckccatggcgtc 2 pepc/c4-3200r atgccaagattttccacttggac
08 September 2011 2,935 5 View
is there any ways that i can find genome similarity of an organism without whole genome sequencing ,like using maths formulas or experimental progress ?
05 July 2024 4,070 3 View
It is known that patients with desminopathy often die from pneumonia. Have pathomorphological studies of the lungs been performed in patients with desminopathy?
15 June 2024 1,355 7 View
I found a variant segregating with a genetic condition, this variant is listed in ClinVar (with no clinical significance), gnomAD, etc. However, I could not find any publication reporting the...
10 June 2024 7,606 3 View
Describe the principles of Population Genetics and evolution as applied to livestock breeding programs
08 June 2024 2,924 0 View
I used hygromycin and kanamycin for selecting positive buds in Micro-tom genetic transformation. Kanamycin performed very well and I could get positive plants soon, but hygromycin is a little bit...
29 May 2024 6,911 0 View
Hi, I've recently come across the colony of Geothrichum silvicola (based on sequencing result) isolated from soil with slimy morphology, unlike the colony morphology I've found on the journal...
13 May 2024 1,356 8 View
Hello I am currently engaged in research focusing on plant genetic transformation. As part of this endeavor, I have designed a comprehensive in silico plasmid cloning approach. The aim is to...
07 May 2024 5,119 3 View
I am following the standard method which is mentioned in Tomotake Kanki et al., 2009 research paper Monitoring mitophagy in yeast: The Om45-GFP processing assay . I am growing the cells in SD-HIS...
04 May 2024 6,463 0 View
Who (first) proposed/used/coined the term ‘translation’ in biology/genetics? What is the history behind the use of the word? Thank you!
01 May 2024 4,528 10 View
Can anyone assist with running the Linkage Analysis Tool 'Easylinkage' or any alternative tool for conducting linkage analysis and calculating LOD scores?
06 April 2024 7,273 2 View