Marjan Jafarpour

16 Questions 29 Answers 0 Followers

Questions related from Marjan Jafarpour

Is checking heterogeneity necessary for pre-test?

Dear allI have 7 formative constructs with 63 items and every constucts has 9 indicators.I run my data for PLS.I need to taste heterogeneity for the pre-test.Is any specific test for that? I...

02 February 2015 7,290 4 View

What is the sampling method for my quantitative survey?

I listed events from which samples of a study were taken. I do not know the whole population. I participated in all of them during 6 months and I gave the questionnaire to all of the people who...

05 May 2014 4,222 13 View

Can anyone help with non probability sampling?

As I know and read in books, we cannot use the non probability method for inferential analysis. We can only use descriptive statistics for non-probability sampling. Do you know any thesis or...

05 May 2014 3,582 45 View

Direction of questions in questionnaire?

For testing reliability/statistic work on data, all the questions for every construct (for example attitude) should be in the same direction in terms of being agree or disagree? If the questions...

11 November 2013 5,808 5 View

The primers with high TM temprature

I designed a primer with high Tm temperature (74, 70) [I could not find a better primer. In addition, before PCR, I have to do RT-PCR to convert RNA to c DNA] 1. What kind of PCR do you suggest...

10 October 2011 7,774 1 View

primers with high Tm temperature

I designed a primer with high Tm temperature (74, 70) [I could not find a better primer. In addition, before PCR, I have to do RT-PCR to convert RNA to c DNA] 1. What kind of PCR do you suggest...

10 October 2011 3,309 5 View

Some problems related to design primer:

Back ground: I decide to transfer Gene related to Saccharum officinarum into the other plant and then express. Then I just need ORF .I should design the primer for the first step after extracting...

10 October 2011 3,378 12 View

Some problems related to design primer for the gene of intrest:

Back ground: I decide to transfer Gene related to Saccharum officinarum into the other plant and then express. Then I just need ORF .I should design the primer for the first step after extracting...

10 October 2011 5,664 3 View

Dear all, If any one how we can use the result of allignment of sequences, please leave a message...I allign the sequences by clustal w...tnx

1. I need the results for design the primer.

09 September 2011 8,947 12 View

Dear all, How manually editing multiple alignment

What factors are important for editing?

09 September 2011 2,868 3 View

Dear all. I got this primer from article (Besnard, 2003); I do not know what are M,S and K?

1 pepc/c4-0f ccgmggmsckccatggcgtc 2 pepc/c4-3200r atgccaagattttccacttggac

09 September 2011 2,916 5 View

Multiple Alignment

How manually editing multiple alignment? What factors are important for editing?

09 September 2011 9,182 2 View

Multiple alignment, Important Factors in alignment:

How manually editing multiple alignment? What factors are important for editing?

09 September 2011 1,606 4 View

RNA EXTRACTION

If anyone have exprience in RNA extraction and has suggestions for improving results , please send me a message?

06 June 2011 4,890 4 View

look for a research position

I look for a phd research position in high qualified institute.Now I am working on overexpression of 2 enzymes from c4 plants to c3 plants as phd student. If anyone can introduce me a good job...

03 March 2011 2,858 0 View

look for a research position

I look for a phd research position in high qualified institute.Now I am working on overexpression of 2 enzymes from c4 plants to c3 plants as phd student. If anyone can introduce me a good job...

03 March 2011 626 0 View