16 Questions 29 Answers 0 Followers
Questions related from Marjan Jafarpour
Dear allI have 7 formative constructs with 63 items and every constucts has 9 indicators.I run my data for PLS.I need to taste heterogeneity for the pre-test.Is any specific test for that? I...
02 February 2015 7,303 4 View
I listed events from which samples of a study were taken. I do not know the whole population. I participated in all of them during 6 months and I gave the questionnaire to all of the people who...
05 May 2014 4,244 13 View
As I know and read in books, we cannot use the non probability method for inferential analysis. We can only use descriptive statistics for non-probability sampling. Do you know any thesis or...
05 May 2014 3,597 45 View
For testing reliability/statistic work on data, all the questions for every construct (for example attitude) should be in the same direction in terms of being agree or disagree? If the questions...
11 November 2013 5,829 5 View
I designed a primer with high Tm temperature (74, 70) [I could not find a better primer. In addition, before PCR, I have to do RT-PCR to convert RNA to c DNA] 1. What kind of PCR do you suggest...
10 October 2011 7,794 1 View
10 October 2011 3,326 5 View
Back ground: I decide to transfer Gene related to Saccharum officinarum into the other plant and then express. Then I just need ORF .I should design the primer for the first step after extracting...
10 October 2011 3,391 12 View
10 October 2011 5,679 3 View
1. I need the results for design the primer.
09 September 2011 8,956 12 View
What factors are important for editing?
09 September 2011 2,882 3 View
1 pepc/c4-0f ccgmggmsckccatggcgtc 2 pepc/c4-3200r atgccaagattttccacttggac
09 September 2011 2,928 5 View
How manually editing multiple alignment? What factors are important for editing?
09 September 2011 9,195 2 View
09 September 2011 1,617 4 View
If anyone have exprience in RNA extraction and has suggestions for improving results , please send me a message?
06 June 2011 4,900 4 View
I look for a phd research position in high qualified institute.Now I am working on overexpression of 2 enzymes from c4 plants to c3 plants as phd student. If anyone can introduce me a good job...
03 March 2011 2,869 0 View
03 March 2011 637 0 View