Is checking heterogeneity necessary for pre-test?

Dear allI have 7 formative constructs with 63 items and every constucts has 9 indicators.I run my data for PLS.I need to taste heterogeneity for the pre-test.Is any specific test for that? I...

01 February 2015 7,266 4 View

What is the sampling method for my quantitative survey?

I listed events from which samples of a study were taken. I do not know the whole population. I participated in all of them during 6 months and I gave the questionnaire to all of the people who...

04 May 2014 4,192 13 View

Can anyone help with non probability sampling?

As I know and read in books, we cannot use the non probability method for inferential analysis. We can only use descriptive statistics for non-probability sampling. Do you know any thesis or...

04 May 2014 3,541 45 View

Direction of questions in questionnaire?

For testing reliability/statistic work on data, all the questions for every construct (for example attitude) should be in the same direction in terms of being agree or disagree? If the questions...

10 November 2013 5,760 5 View

primers with high Tm temperature

I designed a primer with high Tm temperature (74, 70) [I could not find a better primer. In addition, before PCR, I have to do RT-PCR to convert RNA to c DNA] 1. What kind of PCR do you suggest...

09 October 2011 3,283 5 View

Some problems related to design primer:

Back ground: I decide to transfer Gene related to Saccharum officinarum into the other plant and then express. Then I just need ORF .I should design the primer for the first step after extracting...

09 October 2011 3,350 12 View

Some problems related to design primer for the gene of intrest:

Back ground: I decide to transfer Gene related to Saccharum officinarum into the other plant and then express. Then I just need ORF .I should design the primer for the first step after extracting...

09 October 2011 5,633 3 View

The primers with high TM temprature

I designed a primer with high Tm temperature (74, 70) [I could not find a better primer. In addition, before PCR, I have to do RT-PCR to convert RNA to c DNA] 1. What kind of PCR do you suggest...

09 October 2011 7,745 1 View

Dear all, How manually editing multiple alignment

What factors are important for editing?

08 September 2011 2,837 3 View

Dear all. I got this primer from article (Besnard, 2003); I do not know what are M,S and K?

1 pepc/c4-0f ccgmggmsckccatggcgtc 2 pepc/c4-3200r atgccaagattttccacttggac

08 September 2011 2,879 5 View

No title

02 March 2021 3,060 3 View

What do you know about biotechnology art?

What do you know about biotechnology art?

02 March 2021 1,653 3 View

Which is the best place in the world for the plant biotechnology research?

I am searching for a good place for the Post Doc,

02 March 2021 4,053 3 View

Is CD44 degraded in lysosome together with hyaluronan after CD44 mediated endocytosis of hyaluronic acid?

Also when RHAMM binds hyaluronic acid, they get internalized, will RHAMM also be degraded? Or both CD44 and RHAMM will be transferred back to the cell membrane? Asking for breast cancer cell line...

01 March 2021 8,169 2 View

How was your experience with Biomedical and Biotechnology Journal?

How was your publication experience with BBRJ in terms of peer review and reviewer comments. Did you find it fair and transparent ?

23 February 2021 3,810 6 View

Are the topics below viable research in plant biotechnology?

1. Chemically induced mutagenesis in seed and qPCR detection and amplification of desired trait. 2. Site-directed mutagenesis in qualitative traits of a multiline seed.

04 February 2021 9,069 3 View

Is receiving Invitation to submit a article from the journal is big deal ???

I have recently received a invitation from the journal "Current Pharmaceutical Bio-technology" to submit a research article. As i didn't received any invitation before. so, is it normal to to...

04 February 2021 4,596 23 View

Why is Fermented Plant Juice (FPJ) always diluted with water? Could it be diluted with other solvents such as rice water?

I am currently making a research paper with my classmates in Philippine Science High School and we are trying to find references that mixed Fermented Plant Juice with other solvents instead of...

17 January 2021 5,099 4 View

What steps should one take to address post-harvest disease problems in a supply chain?

If I were to receive an import of a new fruit species in the country and, upon arrival, the whole lot was diseased, what steps do I take to diagnose and solve the problem? Is there a general...

10 January 2021 1,649 7 View

Why negative controls also showing the specific bands of promotor and other regions (GUS, GFP etc.)?

Dear Researchers, I did a transformation of an empty vector (pCAMBIA1301/1302) into my passion fruit plants, for the optimization of the transformation protocol. After transformation; DNA...

06 January 2021 8,465 99 View