Multiple alignment, Important Factors in alignment:

More Marjan Jafarpour's questions See All

Is checking heterogeneity necessary for pre-test?

Dear allI have 7 formative constructs with 63 items and every constucts has 9 indicators.I run my data for PLS.I need to taste heterogeneity for the pre-test.Is any specific test for that? I...

01 February 2015 7,308 4 View

What is the sampling method for my quantitative survey?

I listed events from which samples of a study were taken. I do not know the whole population. I participated in all of them during 6 months and I gave the questionnaire to all of the people who...

04 May 2014 4,254 13 View

Can anyone help with non probability sampling?

As I know and read in books, we cannot use the non probability method for inferential analysis. We can only use descriptive statistics for non-probability sampling. Do you know any thesis or...

04 May 2014 3,603 45 View

Direction of questions in questionnaire?

For testing reliability/statistic work on data, all the questions for every construct (for example attitude) should be in the same direction in terms of being agree or disagree? If the questions...

10 November 2013 5,840 5 View

primers with high Tm temperature

I designed a primer with high Tm temperature (74, 70) [I could not find a better primer. In addition, before PCR, I have to do RT-PCR to convert RNA to c DNA] 1. What kind of PCR do you suggest...

09 October 2011 3,331 5 View

Some problems related to design primer:

Back ground: I decide to transfer Gene related to Saccharum officinarum into the other plant and then express. Then I just need ORF .I should design the primer for the first step after extracting...

09 October 2011 3,396 12 View

Some problems related to design primer for the gene of intrest:

Back ground: I decide to transfer Gene related to Saccharum officinarum into the other plant and then express. Then I just need ORF .I should design the primer for the first step after extracting...

09 October 2011 5,685 3 View

The primers with high TM temprature

I designed a primer with high Tm temperature (74, 70) [I could not find a better primer. In addition, before PCR, I have to do RT-PCR to convert RNA to c DNA] 1. What kind of PCR do you suggest...

09 October 2011 7,801 1 View

Dear all, How manually editing multiple alignment

What factors are important for editing?

08 September 2011 2,887 3 View

Dear all. I got this primer from article (Besnard, 2003); I do not know what are M,S and K?

1 pepc/c4-0f ccgmggmsckccatggcgtc 2 pepc/c4-3200r atgccaagattttccacttggac

08 September 2011 2,935 5 View

What exactly is it about biotechnology and medical research?

I'm very interested in biotechnology and medical research and I'd like to meet a professional here and talk about it together

28 July 2024 3,798 4 View

How does the Retention time effect the Biogas Production?

List down the various factors responsible and how does this effect the overall biogas production when it is related to Hydraulic retention time of the digester based on the feedstock?

27 July 2024 4,800 4 View

Do you know CUSABIO Biotechnology Scholarships for Students 2024?

I am pleased to announce the CUSABIO Biotechnology Scholarships for Students 2024! This scholarship aims to support outstanding students pursuing studies in the field of biotechnology. Here are...

22 July 2024 5,790 1 View

Is it possible to generate a (semi-)permanent "transcription bubble" within a replicable plasmid?

I was wondering if it is possible to form a permanent open "ssDNA bubble" similar to a transcription bubble (>13 nucleotides) within E. coli. These criteria are important: 1. Open ssDNA...

07 July 2024 8,275 5 View

What are the regulatory guidelines to submit a microorganism as Generally Regarded as Safe ?

Give in detail with available literature and website links for submissions

27 June 2024 9,753 1 View

Has anyone used or is familiar with an anti-C4 complement factor antibody for Western Blotting?

Hey everyone! I'm having difficulty marking the C4 complement factor in Western Blotting. Has anyone had contact with this antibody or made it in-house? I have already used Anti-C4β (D-12)...

17 June 2024 6,124 1 View

Does age of a bacterial culture have an impact on its DNA isolation?

Generally for bacterial DNA isolation we use a fresh culture of 2-5 days old. But if we use an older culture say 10-15 days old will it have any impact on the DNA content and the DNA isolation...

13 May 2024 3,061 11 View

Why does soybean half-seed transformation use 1/10x B5 salts during co-cultivation?

I was curious as to why modern soybean half-seed protocols use 1/10x strength B5 salts during the co-cultivation step rather than full strength B5 salts? Also, are the B5 vitamins added at full...

07 May 2024 3,924 0 View

Why I am not getting accumulated GFP in vacuole for om45 WT GFP yeast strains?

I am following the standard method which is mentioned in Tomotake Kanki et al., 2009 research paper Monitoring mitophagy in yeast: The Om45-GFP processing assay . I am growing the cells in SD-HIS...

04 May 2024 6,463 0 View

What are the genetic mechanisms governing the production of secondary metabolites in microorganisms?

How are these exploited in biotechnological applications?

07 April 2024 566 5 View