At what nanometer should we take the OD of quencher and probe?
i want to use phenol red for LAMP assay but its not getting dissolved in NFW. Which other solvent can be used to dissolve the same and will not affect the LAMP reaction?
03 August 2023 3,966 3 View
I have resuspended my primers in NFW to get the final concentration of 100uM. Now i want to confirm that the concentration is 100uM.. how can i do that?? i have tried spectrophotography to confirm...
19 February 2023 8,922 2 View
19 February 2023 1,562 0 View
Belsorp mini II is being used in our lab to perform surface area measurement through N2 adsorption-desorption. The arising problem is that some samples fail to attain equilibrium while...
07 February 2023 8,330 2 View
I have synthesized chitosan nanoparticles. And I'm looking for an alternative method for freeze drying, in order to remove the solvent and obtain dried chitosan nanoparticles.
02 April 2021 2,946 3 View
I want to Perform multiphoton microscopic analysis in ex vivo living mouse brain slices cyclically exposed to conditions that promote disassembly and recovery of synaptic...
24 June 2018 5,657 0 View
Interested in looking into dendritic spine morphology in deeper areas of (250 micron deeper from surface) live brain sections which are constantly perfused with ACSF. Typical imaging time for one...
14 December 2017 1,140 0 View
How to calculate relative gene expression in real time PCR if Ct value of reference sample is undetermined or comes almost 37 or so.
07 January 2015 7,164 9 View
We have already studied microRNA profiling of BM-MSCs also ESCs-MSCs and Adipo derived MSCs. But I am looking for a certain set of microRNAs which are highly specific to mesenchymal stem cells.
02 January 2014 222 2 View
How to check RNAse contamination in consumables and materials in house??
01 January 1970 7,513 0 View
Hi everyone, Recently I have been conducting Dynamic Light scattering experiments in a micellar solution at 5 and gel at 37 degrees of Celsius with latex particles of diameter 190-500 nm. While...
01 August 2024 1,168 4 View
Hello, I'm trying to measure the conductivity of semiconductor films but since I don't have a commercial four point probe set up I would like to build one on my own in my lab. I have generators,...
30 July 2024 906 2 View
I designed 2 dual hybridization probes for my single SNP. where I attach my fluorophore 5'-FAM-nnnn-BHQ1-3', and 5'-HEX-nnnnnn-BHQ2-3'. I need to run it on the MIC RT PCR machine by Biomolecular...
28 July 2024 5,658 0 View
Dear colleagues, We are trying to do FISH on mice PDEC metaphase spreads. We use homemade biotin labelled probes, synthetized using a nick translation kit. For hybridization, initially we were...
08 July 2024 8,687 3 View
I have a target of sequences for primer design for qPCR with taqman. The issue is that when I design a sense probe the probe makes dimers with forward and reverse with a very high probability at...
16 June 2024 1,506 1 View
Hi all, you know this lncRNA has 12 exons and 50 isoforms that just have similar sequences in exon 12. Coud someone recommend me primers for this exon with no need of probes?
15 June 2024 8,055 0 View
It is very common to measure the pressure distribution inside the bearings with pressure probes connected to the oil film through holes in the bush. Once filled and pressurized, the probe lines...
12 June 2024 1,936 0 View
I was recently performing a great deal of qPCRs on adipose tissue derived RNA. I had experimental samples from sick, and control samples from healthy individuals. I used the same chemistry for all...
04 June 2024 6,924 0 View
this primer and probe are specific to the mthfr gene (C677T) AGGCCAGCCTCTCCTGACTG AGGACGGTGCGGTGAGAGTG Taq man probe: CGGGAGCCGATTTCATCA—FL 640-CGCAGCTTTTCTTTGAGGCTGACA—PH
03 June 2024 239 2 View
Hi, I am looking for some low molecular weight organic compound/dye that absorbs light above 600 nm up to 750 nm with a decent absorptivity, that is reactive to amines or has a carboxilic acid...
22 May 2024 2,803 5 View
