If you need higher accuracy than whatever the difference between the different prediction methods is, then the only way to get that is to measure it experimentally, by doing a melting curve. For example any modern RT-PCR cycler should come with software that lets you do that conveniently.

Thanx john

The best formula ever for primers above 14 bp of length

Tm = 69.3 + (0.41 x GC%) - (650/primer length)

for example Tm of primer (ATGCATGCATGCATGCATGCATGCATGC) would be

Tm= 69.3 + (0.41 x 50) - (650/28)

Tm = 66.59 °C

Annealing temp = Tm - 5°C

Annealing temp = 66.59 - 5°C

Annealing temp = 61.59 = 62 (round off) ...have fun

Hey let me also add....stem lope cannot survive at annealing temperatures...so stop worrying about them...do some maths and you will agree with me

Hi, have a look here: http://www.basic.northwestern.edu/biotools/oligocalc.html

All the best, Nadine

I generally use pearlprimer program. You can download it and when you write your primer sequences it calculates automaticly. Good luck

IDT's program is actually pretty good, and does a good job accounting for conditions typically found in PCR, as well as many common modifications.

Hi,

Why don't you use oligo.I used it and always got me an annealing temperature that is either nearly the same or identical to one described in papers for the primer I want to use.

Good luck.

The rule of thumb is to use an annealing temperature that is 5°C lower than the Tm of the primer.

To calculate the primer Tm, use the tool at www.basic.northwestern.edu/biotools/oligocalc.html with the default salt concentration and 0.2–1 μM primer (depending on your reaction conditions). Use the lowest primer Tm when calculating the annealing temperature. For greater accuracy, optimize the annealing temperature by using a thermal gradient.

I agree with John. The most reliable way of determining primer Tm is to determine it experimentally under the conditions where you use it. Get the reverse complement synthesised, mix it with your primer in SYBR-green mastermix, and then run a Tm analysis. It's possible that some of the programs have been validated over the full range of mastermix compositions - if so, I'd like to know about them. In my experience the calculated value is correct to +/- 5 degrees.