Can someone suggest an effective electroporation system to proceed to plant protoplast fusion?

More Romain Chablais's questions See All

Fish eggs ID?

Any idea of the species? Catch in may, near roscoff in brittany, No oil globule, size 1.2mm The specimen is well marked with melanophore, and pectoral fins are already pigmented (as seen on...

26 May 2024 7,624 0 View

Which brand of hand vacuum pump do you recommend for suspending particulate organic matter (SPOM) filtration?

I'm looking for a durable and user-friendly system to filter SPOM while on a boat in the field. The last one I used was the Mityvac Hand Vacuum Pump, but the plastic handle broke after intensive...

17 March 2024 3,877 0 View

Why an antibody can recognize a recombinant protein but not the endogenous protein in a western blot ?

I did a western blot with 25ug of protein lysate. As control, i used the recombinant protein and cell who not express my protein. The first antibody (rabbit polyclonal) recognize only the...

14 June 2023 7,853 3 View

Quelle est la meilleur façon de simuler du radium 226 à l'équilibre sur GATE?

Dans le cadre d'un projet d'étude dosimétrique, je me dois d’effectuer une simulation de radium 226 à l'équilibre. Afin d'utiliser au mieux le logiciel GATE, et d’interpréter correctement les...

29 May 2023 8,462 0 View

Why our copy number analysis fluctuates with Quantibrite PE beads?

Hi, I have a question about FACS and copy number estimation of a protein of interest. We have a protein of interest (on the membrane surface) that we are studying and we have an antibody coupled...

21 February 2023 1,931 0 View

Culture medium SGM17 fluoresce (GFP)?

Hello everyone, I am looking to study the fluorescence intensity of GFP in a GRAM positive bacterium. The culture medium is M17+sucrose+glucose. Does this medium fluoresce in the GFP wavelengths?...

14 February 2022 7,195 2 View

What do I still have multiple bands after isolating each bands through Gel extraction ?

Hi, I'm trying to develop a KO cell line from an established cancer cell line. My gene of interest is present in 3 copies in this cell line. I'm using a multi-sgRNAs technique to increase my...

01 December 2021 8,770 5 View

SMAP L4 Carbon product: suitable for all ecosystems?

Hi there, Working on C fluxes and stocks quantification, I would like to know if SMAP L4 Carbon products are reliable enough for other ecosystems than boreal forests (GPP, NEE, RH, SOC). Indeed,...

20 July 2021 7,251 0 View

What is the trouble with my base editing ?

Hi, I'm trying to do a base editing. My target gene is MYBBP3A, the guide RNA I'm using is ACTCGCGACTGTGCTTCAAT and I cloned it in the pLentiguide-puro (Addgene 52963). I used this guide because...

27 June 2021 2,139 7 View

Why my transformation does not work after successful ligation ?

Hello everyone, I'm really not familiar with molecular biology protocols, and I try to obtain several constructs of my protein by doing PCRs and ligation starting from a WT-plasmid. I...

13 May 2021 2,871 7 View

Why Do TDS and EC Increase with Larger Wastewater Volumes, While BOD and COD Decrease?

I have carried out MFC experiments on three different volumes, 50, 500 and 1000 mL of wastewater. Results after MFC treatment shows that TDS and EC are more in larger volumes of water i.e. TDS and...

09 August 2024 9,621 0 View

Do I need specific antibodies to stain for a fusion protein?

I am staining some brain sections stored in cryoprotectant that express a Histone H2B- GFP fusion protein that were generated ~10 years ago. I know I need to enhance signal with an anti-GFP...

07 August 2024 5,338 2 View

How do soil microflora interact with plant roots and influence plant nutrition, health, and productivity?

06 August 2024 9,618 3 View

Are there instances where molecules with larger molecular weights exhibit greater mobility than those with smaller molecular weights?

Hi, I know that low molecular weight (MW) molecules generally tend to have higher mobility, while high molecular weight molecules tend to have lower mobility. However, in my experimental...

06 August 2024 1,495 2 View

Weak DAPI staining after immunohistochemistry - how to improve?

After immunohistochemistry of previously fixed in PFA and EtOH and then frozen 20 μm sections of zebrafish brain, DAPI staining is very weak (right) compared to the same sections stained without...

05 August 2024 9,637 2 View

The Curse of Evolution and Complexity?

Brain and body mass together are positively correlated with lifespan (Hofman 1993). The duration of neural development is one of the best predictors of brain size, and conception is the best...

05 August 2024 6,247 3 View

For an in-vitro drug release study, what molecular weight cut-off (MWCO) dialysis bag is required for a 117 kDa protein?

kindly reply me. Thanking you in advance.

05 August 2024 7,727 4 View

How to start a Molecular Dynamics Simulation?

Is it possible to conduct a molecular dynamics simulation to see the effects of a specific carbohydrate on the structure of lipids (e.g., micelle structure)? I am a beginner in this field and plan...

03 August 2024 3,371 3 View

Which will be the best software for the Hydration shell analysis with molecular dynamics?

I am using a windows system, what software I should use for hydration shell analysis with molecular dynamics?

02 August 2024 3,143 4 View

Can anyone provide me with molecular docking softwares/ websites?

Molecular docking software/ websites?

02 August 2024 8,704 7 View