I know this may seem a little silly to ask, I bet there is a straight forward answer, but I have no clue. I want to use the restriction enzyme NheI to cut my gene of interest, but it has CPG methylation sensitivity resulting in no digestion. Normally I work with bacteria so methylation sensitivity isnt a problem, but this particular vector is a eukaryotic vector, so now methylation is an issue I am highly unfamiliar with. Since my gene of interest doesnt actually contain an NheI cut site, I was hoping to design primers such that an NheI cut site is added before the 5' end of my gene following PCR, this way way following digestion with NheI I will have the correct sticky ends to insert my gene into a vector also cut with NheI, the vector NheI site is naturally there already (I am not adding it). So my question is, how can I tell if my DNA of interest is CPG methylated if all I have is a plasmid map and DNA sequence on Vector NTI? Does adding the NheI cut site through PCR primers resolve this methylation issue or no? Or are there any suggestions to get around this issue maybe? I know a quick solution would be to choose a new enzyme, but this enzyme is non-ambiguous in my gene and is the only enzyme that works for my vector, so I really need it to work, if possible. Below is what NEB states about NheI (- is where it cuts):
5' G-CTAGC 3'
3' CGATC-G 5'
CpG Methylation: Blocked by Some Combinations of Overlapping
CpG site is where a cytosine nucleotide occurs next to a guanine nucleotide in the linear sequence (not the base pair GC). These can be methylated to form 5-methylcytosine.
This is the sequence of my gene of interest (starting at ATG), I included a few bases before the gene just in case it was useful for suggestions, I want to add the NheI cut site before the ATG of my gene, I could maybe add a spacer sequence between (ggg NheI aaa), Id love suggestions on how to do this if this works?:
5' cagcagtcatgag 3'
3' gtcgtcagtactc 5'
Hi Emily,
In your case you don't have to bother with CG methylation. First, even with a eukaryotic vector you do all of your cloning strps in E. coli. Therefore, you will not get any CG methylation. This will be only of relevance when you integrate your DNA in mammalian cells and plan to characterize your integrates with NheI.Even if you do this you can avoid methylation by ommitting a C 5' or a G 3' of the NheI site.
Concerning your construct add a few flanking nucleotides for efficient restriction digestion followed by the NheI site. Ifyou want to achieve robust protein expression add a Kozak consensus sequence ( in bold)
e-g..:
atat GCTAGC c gcc acc ATG
Looking at this today, I noticed that I don't think that I can use NheI...So if NheI contains a TAG stop codon in its recognition sequence, and I add it to the 5' of my gene insert, now I effectively have promoter-NheI-TAG stop-ATG gene, inhibiting my gene from being expressed. Is this the correct interpretation of that? I now understand that the CpG methylation isn't an issue until introduced to a eukaryote, so thank you for that, that saved me hours of Google search.
Translational stop codons don't affect transcription. Therefore you can ignore them when they are located in the promoter or in the 5'-UTR. In caseyYou you want to generate a fusion protein, e.g. "EGFP-gene of interest" the linker should not include an in-frame stop codon. In the example above the TAG is not even in-frame: CTA GCC GCC ACC ATG
Well I need this to be a functional protein as well, I need to use gene-EGFP to determine cellular localization. This is the sense primer that I had designed, where - is where it cuts, bold are spacers:
5' AGC AG-C TAG C ATGAGCTCCGACGCCGAGAT 3'
Is it that when NheI cuts that this is what forms?
5' CTA GCA TGA NNN 3'
If I understand what your saying. In that case not only is the TAG stop out of frame after the cut by NheI, but so is my start ATG, so I still wont get the correct translation.
What about this sense primer?
5' AGC ACT G-CT AGC AGT GAT GAG CTC... 3'
Which makes this digestion product?
5' CTA GCA GTG ATG AGC TCC... 3'
In that case, if I understand correctly, then by adding those spacers in front and in back I can change the reading frame such that the TAG stop is out of frame and the final digestion product has ATG in frame? Would this work and give me a successful gene fusion for translation of gene-EGFP?
Hi Emily,
If I understand it right, the NheI site precedes your start ATG. When you clone your PCR fragment into an expression vector a promoter will precede your NheI site. Irrespectively of the introduced cloning sequence your ATG defines the reading frame. All you should avoid additional ATGs. To enhance translation you may include a Kozak consensus sequence. When you do this you will express an untagged protein.
The approach differs if you want to express gene-EGFP: You may use the same forward primer but you have to skip the stop codon in the reverse primer. Here the reading frame matters. Your gene-orf and the EGFP-orf have to be in frame.
For EGFP-gene your forward oligo should not include a Kozak sequence but after ligation the the EGFP-orf and the gene orf have to be in frame. This is easy to design since you my add 1 or 2 nucleotides preceding your orf.
A general tip: Use a program which allows you to control what you have designed. I can recommend the freeware program SerialCloner. (Generate files for the vectors and your PCR product, then use the "assemble" menue.
- Badges
- Science topic