Bio rad c1000 thermal cycler lid knob problem?

Musa Mohammadi @Musa_Mohammadi

01 January 2016 0 3K Report

Hi evey one.

We have Bio rad c1000 thermal cycler.

Last time I used C 1000 it was ok, but now it's lid force knob is broken. lid knob is fixed and does not move.

what shold I do?

Badges
Science method

More Musa Mohammadi's questions See All

Which Linux distro do you like for Bioinformatics?

Every one who deals with bioinformatics suggests to work in Linux. But as begginer I'm confused with these Linux distros, some suggest the Ubuntu, other suggests Fedora and ... . But I want to...

08 September 2017 1,943 33 View

Database for viral diseases of plant

Is there any updated database for viral diseases of plant, I need to know host susceptibility some plants. I found one ( http://sdb.im.ac.cn/vide/refs.htm ) but it seems it's not updated. or it's...

07 August 2017 6,656 5 View

Best program for NGS data quality control

I'm new to NGS anlysis, there are many QC (quality control ) software for NGS data, which one is best? I'm using https://usegalaxy.org so it's better to be available in this web sever. or is there...

07 August 2017 2,758 12 View

How to use Galaxy project?

How can I use galaxyproject.org for analyzing NGS data? I need a simple manual to use it.

07 August 2017 8,863 3 View

Is there any precursor miRNA in plant viruses?

I'm interested in RNAi. I found some article about precursor miRNA in human viruses. but I want to know if there is any precursor miRNA in plant viruses. if you read some article about precursor...

10 November 2015 471 1 View

Any advice on a wrong PCR product size?

I amplified a gene(np gene of TSWV) form total RNA. total RNA was extracted from leaf of tobacco. I had used these primer pair: F : ATGTCTAAGGTTAAGCTCACTA R : TTAAGCAAGTTCTGTGAGTT these primer...

09 October 2015 6,027 9 View

How to learn more about SPSS and its Application?

I would like to learn more about SPSS and Its application especially in regards to data analysis. Please suggest me how I can learn more about it. Thank you so much.

11 August 2024 9,101 4 View

Can I base on reverse DNA sequences to perform alignment, convert to amino acids and GenBank submission?

I have reverse sequences (AB1 format), can I base on reverse DNA sequences to perform nucleotide alignment, convert nucleotides to amino acids and deposit the sequence in GenBank database?

11 August 2024 5,138 1 View

Baseline drift in HPLC? What causes this?

Hello, Why do i see this baseline drift when i compare my blank (black) to the sample (blue)? Any suggestions as to why this happened? Thank you!

11 August 2024 3,770 4 View

Text-Communication from the M1 Hand Area using BCI—and then there is Elon Musk?

Willett, Shenoy et al. (2021) have developed a brain computer interface (BCI) that used neural signal collected from the hand area of the motor cortex (area M1) of a paralyzed patient. The...

10 August 2024 7,180 0 View

Has anyone applied Python in the field of textile engineering for data analysis, automation, or smart textiles?

I'm currently exploring the application of Python in textile engineering, specifically in areas like data analysis, process automation, and the development of smart textiles. I'm interested in...

10 August 2024 7,429 2 View

How can I use the cif data obtained from rietveld refinement extracted via gsas2, for microstructural analysis using ETEX software?

09 August 2024 7,718 0 View

How to confirm the site-directed mutagenesis result without performing NGS?

I'm cloning a fragment of 3200 nts into plasmid. The cloning was successful, however, 02 amino acids were mutated. Now I want to fix these 02 aa by site-directed mutagenesis technique using...

08 August 2024 4,645 2 View

I can't see the ssDNA band after performing asymmetric PCR. Is there any way to do this?

After performing symmetric PCR, PCR purification was performed. Afterwards, asymmetric PCR was performed using the PCR purification product as a template, but no ssDNA band was confirmed in the...

08 August 2024 1,668 3 View

How are iso-frequency contours plotted?

Let's say we have a standard, regular hexagonal honeycomb with a 3-arm primitive unit cell (something like the figure attached; the figure is only representative and not drawn to scale). The...

07 August 2024 1,937 1 View

How to prepare the nanoparticle treated fungal sample for Environmental SEM analysis?

A fungal strain was treated with nanoparticles. We want to do an environmental SEM analysis. So could anyone share your views on preparing the sample? Thank you.

07 August 2024 5,307 1 View