7 Questions 12 Answers 0 Followers
Questions related from Musa Mohammadi
Every one who deals with bioinformatics suggests to work in Linux. But as begginer I'm confused with these Linux distros, some suggest the Ubuntu, other suggests Fedora and ... . But I want to...
09 September 2017 1,943 33 View
Is there any updated database for viral diseases of plant, I need to know host susceptibility some plants. I found one ( http://sdb.im.ac.cn/vide/refs.htm ) but it seems it's not updated. or it's...
08 August 2017 6,656 5 View
I'm new to NGS anlysis, there are many QC (quality control ) software for NGS data, which one is best? I'm using https://usegalaxy.org so it's better to be available in this web sever. or is there...
08 August 2017 2,758 12 View
How can I use galaxyproject.org for analyzing NGS data? I need a simple manual to use it.
08 August 2017 8,863 3 View
Hi evey one. We have Bio rad c1000 thermal cycler. Last time I used C 1000 it was ok, but now it's lid force knob is broken. lid knob is fixed and does not move. what shold I do?
01 January 2016 2,968 0 View
I'm interested in RNAi. I found some article about precursor miRNA in human viruses. but I want to know if there is any precursor miRNA in plant viruses. if you read some article about precursor...
11 November 2015 471 1 View
I amplified a gene(np gene of TSWV) form total RNA. total RNA was extracted from leaf of tobacco. I had used these primer pair: F : ATGTCTAAGGTTAAGCTCACTA R : TTAAGCAAGTTCTGTGAGTT these primer...
10 October 2015 6,027 9 View