I amplified a gene(np gene of TSWV) form total RNA.

total RNA was extracted from leaf of tobacco.

I had used these primer pair:

F : ATGTCTAAGGTTAAGCTCACTA

R : TTAAGCAAGTTCTGTGAGTT

these primer pair amplify 777 bp pcr product.

I had checked these primers in "Primer Blast". primers was specific for TSWV.

but my pcr product is about 500 bp.

what is there problem, why pcr product is not 777 bp?

the pcr cycle was:

94     --- 94      51     70     X35  ---  70 

3:00   ---0:30   0:30  1:00         ----  10:00

I had used Red Master Mix from Ampilicon.

Similar questions and discussions