Dear Researchers,
I did scanning electron microscopy (SEM) of the fruit peel and founded different structure during SEM,
Are these fungus body structure (mycelium or hphae) or any other things?
I have to develop a method that can be good enough to run dozens of samples that include urea as the main compound. I prefer an HPLC method because of the convenience of running large numbers of...
01 February 2021 1,888 4 View
Dear researcher, After amplifying my target gene (1900bp) into the required cDNA by PCR,>cut specific gel bands and purify the gel and the concentration was 30ng/ul. Next, performed A-Tailing...
21 January 2021 2,671 3 View
Dear researchers: If the plant genome has not been released yet, can Unigenes from RNA sequences be used after BLAST and confirmed with known Arabidopsis genes for function/overexpression...
20 January 2021 5,557 2 View
HDPE samples were aged at higher temperatures in the presence of water and CO2 than the TGA test was performed in Nitrogen? Weight gain is seen in the curve? What could be the possible reason for...
16 January 2021 5,644 2 View
Dear Researchers, I have Transcriptome/Genome data and want to list all the member of a KCS/CER gene family whose Domain AP2/ERF, FAE1_CUT1, according to the Arabidopsis database, so is there...
15 January 2021 2,293 3 View
Dear Researchers, While working on plant gene transformation, so after cDNA + Gene Primer amplification, >the PCR/Gel were purified, so next for A-tailing and TA cloning is mandatory to...
12 January 2021 3,272 34 View
Dear Researchers, I am using pCAMBIA1301/1302 vectors for overexpression study, so can use the same vectors for transient expression? or need to design another vector for transient expression;...
08 January 2021 7,975 2 View
Dear Researchers, I did a transformation of an empty vector (pCAMBIA1301/1302) into my passion fruit plants, for the optimization of the transformation protocol. After transformation; DNA...
06 January 2021 8,465 99 View
i am a beginner in trnsys and need help ... can anyone please guide me
20 December 2020 1,040 3 View
I've done a PCR using primers Forward: CGCCATCAAGGTACCAGTTGA and Reverse: CAGGCTCAGGTACAGCTGGTGG AGTCTGG saw a band at around 400bp and purified my PCR product using QIAquick PCR Purification...
28 November 2020 1,701 7 View
What's the best way to measure growth rates in House sparrow chicks from day 2 to day 10? Since, the growth curve from day 2 to 10 won't be like the "Logistic curve" it might not follow logistic...
03 March 2021 1,401 3 View
i have problem in preparation of liver tissue with bad cell organelles and how i can adjust osmolarity
03 March 2021 8,890 1 View
Hi, I am after the reference below, my library says it cannot obtain a copy either locally or internationally, any help appreciated! Chris Wang ZM, Heshka S, Wielopolski L, Pi-Sunyer FX, Pierson...
03 March 2021 6,193 1 View
The term miscibility refers to the single-phase state in thermodynamics. I do not mean the compatibility of different components. To determine the miscibility I know several techniques such as...
03 March 2021 4,107 4 View
Need to image mesoporous silica nanoparticles using the TEM. Also, need high resolution TEM images to see the mesoporous structure. Kindly suggest what kind of grids to use. Thanks, Shatadru
02 March 2021 1,787 2 View
Is There Any Feasible Method To Test The Efficiency Of Fluorescent Compounds Other Than UV Spectrometers ? Suggestions Would Be Appreciated !
02 March 2021 5,785 3 View
Hi, I am trying to construct a multi-layer fibril structure from a single layer in PyMol by translating the layer along the fibril axis. For now, I am able to use the Translate command in PyMol...
02 March 2021 4,569 4 View
Hello everyone, I had run a mediation model in SmartPLS using questionnaires that were already validated among my statistical population. A professor who edited my paper -though she is not...
01 March 2021 3,052 3 View
In the sem analysis of CaCO3 nanaoparticles, the morphology images showed spherical shaped particles but the proposed morphology for these type of nanoparticles is trigonal. I prepared the...
01 March 2021 1,960 4 View
I have designed reflectarray element to generate OAM beams at 5.8GHz and feeding it though Horn Antenna on HFSS. After full wave simulation, i am not getting desired results i.e Radiation pattern...
01 March 2021 9,701 5 View