Someone suggest me the reaction of 2-nitroimidazole with bromobenze in which imidazole is connected with bromobenzene through alkyl chain.
Lodhi,
See
--- Raju, N. et al Tetrahedron, 48(47), 10233-8; 1992
and the enclosed file may help
Good luck
i hope these articles will be helpful ti you
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3086661/
http://pubs.rsc.org/en/Content/ArticleLanding/2015/QO/C5QO00211G#!divAbstract
http://onlinelibrary.wiley.com/doi/10.1002/jhet.5570190206/abstract
Consider for instance an ANRORC rearrangement at the nitroimidazole together wit the distorsion model proposed by Houk
thanks Adel Amer , Zeeshan & Renato Contreras
Envi-met software
07 August 2024 8,188 1 View
The entropy measured of molecular graphs plays a crucial rule. The network structures in some cases are very lengthy calculations to handle. Some author avoid to construct table where as most...
30 July 2024 3,126 0 View
The first step is to analyze a 2D molecular graph and implement partitioning techniques to calculate the topological indices. Secondly impose statically tools to generate QSPR model, may or may...
24 July 2024 9,644 1 View
Most of the time it is observed that in many manuscripts there are several typo error of topological calculation errors of calculation and partition of edges what ever the type of partitioning it...
22 July 2024 811 0 View
I have been trying to grow Nicotiana benthamiana via tissue culture. I used ethanol and sodium hypochlorite with different concentrations and time duration for seeds sterilization and lastly...
18 June 2024 1,756 3 View
can any budy explain how i calculate the DNA concentration for the 50ul reaction?
22 May 2024 9,557 1 View
If the sequence of the primers are given as: Forward: ATATAGACCAATATTCCTGTTAGCA, Reverse: AAAAATTAGCCGGGCGTAGTGGCG and size of the PCR product is 2500bp, then what will be the PCR profile for the...
22 May 2024 7,777 1 View
Looking for a research and development solution for restoring agriculture and water sources particularly natural springs in Indian Himalayan Region.
20 May 2024 9,717 3 View
The QSPR analysis some time fails to produce relevant answer. what we should do to get improve results.
29 August 2023 7,764 2 View
Where as some authors use 2d model and other use 3d model. How we can distinguish what the difference. Are the results same or different?
27 August 2023 552 2 View
Approximate concentrations are require in compared with the WHO permissible limts
11 August 2024 2,723 1 View
Hey there, As a synthetic chemist delving into theoretical calculations for my imidazolium-based organic molecules, I would greatly appreciate any guidance on the appropriate input instructions...
09 August 2024 5,444 7 View
I'm currently working on calculating the collision cross section (CCS) for various ions, and I'm facing challenges when dealing with sodiated and multiply charged ions. Most of the resources I’ve...
08 August 2024 8,329 0 View
Hello What should be done to separate and identify organic acids in HPC when their RetTime is the same?Like oxalic acid with Propanoic Acid.or acids that have a very close RetTime.
07 August 2024 8,782 3 View
I used humic acid at 0.044 g/kg soil in my pot experiment. But finally, I have to recommend kg/ha. Each pot's soil weight was 11 kg. What is the solution?
02 August 2024 7,186 6 View
Hi everyone, I'd like to better separate two close peaks coming from a bioconversion sample, I'm currently using a C18 KromaPhase 4,6mm Ø.I. SCHARLAU, particle size (µm): 10, pore size (Å): 100,...
30 July 2024 435 3 View
I am currently working on a project involving liposomes and need to determine the maximum volume of siRNA that can be added to a 2.5 mL liposome solution with a total lipid concentration of 10...
30 July 2024 6,420 1 View
Dear Siesta Users, I installed Siesta 5.0.1 and I want to use Grimme's D3 correction. According to the 5.0.1 manual, I could use a few parameters to include the D3 correction in the...
27 July 2024 5,748 0 View
It has been long known that EDC carbodiimide and NHS easter's half life agains hydrolysis are highly related to pH. However, very surprisingly, not yet found a paper giving a table/chart of their...
25 July 2024 8,738 0 View
I run mechanochemical reactions that involves the use of a large amount of catalyst (1:1 molar ratio to the reactant). When I try to understand the effect of amount of catalyst on the reaction, I...
23 July 2024 9,938 1 View