I have a trouble with my pcr reactions and i want to ask you where is my fault.
I designed six primer pairs according to Schuelke's M13 methods but I did not get any reaction.
One of my primers sequences is there;
Reverse;CAGACCTTCACACGCTTGAT
Foward with M13;TGTAAAACGACGGCCAGTAGAGTTGCGGAGAACAGGAT
and FAM labeled M13.
My PCR master mix content is there;
2ul template DNA (50ng)
1,5ul MgCl (25mM)
1,5ul Standart Reaction Buffer
1ul dNTP mix (10mM)
1ul Reverse primer (10mM)
1ul M13-FAM (10mM)
0,5 ul Foward-M13 Primer (10mM)
ddH2O - and my final volume is 20ul.
And add to 8 cycle end of my standart conditions with 53C annealing temprature. My final extension is 15 min.
I tried this conditions number of times with gradient pcr and touchdown pcr but I did not get any results.
hello,
A polymerase is missing in your PCR mix, but I think you just forgot it in the mix content.
Moreover, what is the target of your primer pair ? I tried to "BLAST" your sequence primers against NT database but I had no clear results
I had add polimerase but i forgot write it.
I use core set primers in vitis vinifera, regions are already identified.
But it isn't "not clear result", there is no one result.
I think the published reverse primer sequence is : CGAACCTTCACACGCTTGAT (according to Bowers et al, 1996)
Moreover, bioinformatic analysis (BLAST) of the sequence of the forward primer didn't allow to find perfect match on vitis genome. Indeed, Bowers et al give the following sequence AGAGTTGCGGAGAACAGGAT but bioinformatic analysis give this sequence : AGAGTGGCGGAGAACAGGAT.
Just a detail, according to your mix content, your "Standart Reaction Buffer" should be 13.3X. I think it's wrong it is probably 10X meaning that you should have 2µL per reactions (but I don't think that your PCR reaction can not be failed because of that).
And, I guess that your primer concentrations are 10 µM and not mM (otherwise they would be in excess)
I'm working with the same thing. I found out that the protocol Schuelke recommends does not amplify any fragment at all for 3 loci i have examined.
I'm still not sure why but the protocol that does amplify for me does not include the final cycles of 53ºC specific for the M13 primer.
Also im puzzled about the primer concentrations recommended in that article. Try changing their relative concentration, what i've found is that using less M13 than the concentration of F and R primers works.
The program I'm using can be found on this paper.
Article Subtle genetic connectivity between Mexican Caribbean and so...
- Badges
- Science method