when I get forward and reverse sequence for same PCR product, most converting software offering reverse-complement converting to the reverse sequence instead of reverse conversion to be able to translate nucleotide code to protein. My question is why we use reverse-complement sequence instead of reversed sequence?
hi i will give u a example it might help you. The sequence of a small peptide is
MSSGKRHSQ, The DNA sequence for this is "5'ATGAGTTCTGGGAAGAGACACTCGCAG3' " the reverse complement will be " 5'CTGCGAGTGTCTCTTCCCAGAACTCAT3' ". But if you do just reverse of the reverse sequence 5' GACGCTCACAGAGAAGGGTCTTGAGTA3' and this will translate to a different peptide which is not correct. Hope this will help you
We represent the DNA from 5' to 3'. Forward primer gives 5'-3' sequence of sense strand ( DNA strand from with protein to be made).The sequence got from reverse sequence is from 5'- to 3' of complimentary strand. If you just reverse it , then it will be in 3' to 5'. When you reverse complement the reverse sequence then it will be 5'-3' of sense strand. Now both the sequences represented in 5' to 3' prime direction of sense strand. When we translate the sequence we will get complete amino acid sequence.
Thank you Mr. Mrityunjay and Mr. Ganapati for your answers, Now it is clear to me why I should use reverse complement in translation (in ExPASy for example) I should choose the reverse frame to gate same forward results. Can you tell me please which is the best reversed sequence should I use for BLAST search (Reverse sequence or Complement reverse sequence or Reverse-complement-reverse sequence) ? As I think the last one should be the best as it will mهmics the forward sequence but I want to know what you do always in like this situation as you more experienced than me.
Labeed you are right reverse complement of reverse sequence can be used for BLAST searches.
In BLAST program you can directly feed the sequence obtained by sequencing as query. Program will aromatically search for both the strand. If you are not sure about complete CDS try to use BLASTX, which will consider both strand and all six frames.
http://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastx&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome
Dear Mr. Mrityunjay and Mr. Ganapati thanks aloat for your fast responding. I actually used BLAST X but I just wanted to know if it is using the six frames or just three of them. Now could you help me please by candidate a robust online software able to use the forward and revers sequences to correct faults in each others and produce integrated sequence to be used in sequence analysis?
Hi All,
I have been trying to design primers for an assay that I am working on, In the design process, I would highlight the region of interest that I want to amplify and then using a softqare (Snapgene), I would comad it to make the primers and it would run and give the primer sequences.
Now from the sequence output, my question is...do i have to again get the reverse complement of the reverse primer as the sequence to order along with the forward sequence Or I should just use the reverse primer sequence outputed from the software wwithout changing anything. Many thanks in advance for your feedback!
- Badges
- Science method