Any Suggestions or Comments ???
Dear researcher, After amplifying my target gene (1900bp) into the required cDNA by PCR,>cut specific gel bands and purify the gel and the concentration was 30ng/ul. Next, performed A-Tailing...
21 January 2021 2,671 3 View
Dear researchers: If the plant genome has not been released yet, can Unigenes from RNA sequences be used after BLAST and confirmed with known Arabidopsis genes for function/overexpression...
20 January 2021 5,557 2 View
Dear Researchers, I have Transcriptome/Genome data and want to list all the member of a KCS/CER gene family whose Domain AP2/ERF, FAE1_CUT1, according to the Arabidopsis database, so is there...
15 January 2021 2,293 3 View
Dear Researchers, While working on plant gene transformation, so after cDNA + Gene Primer amplification, >the PCR/Gel were purified, so next for A-tailing and TA cloning is mandatory to...
12 January 2021 3,272 34 View
Dear Researchers, I am using pCAMBIA1301/1302 vectors for overexpression study, so can use the same vectors for transient expression? or need to design another vector for transient expression;...
08 January 2021 7,975 2 View
Dear Researchers, I did a transformation of an empty vector (pCAMBIA1301/1302) into my passion fruit plants, for the optimization of the transformation protocol. After transformation; DNA...
06 January 2021 8,465 99 View
I've done a PCR using primers Forward: CGCCATCAAGGTACCAGTTGA and Reverse: CAGGCTCAGGTACAGCTGGTGG AGTCTGG saw a band at around 400bp and purified my PCR product using QIAquick PCR Purification...
28 November 2020 1,701 7 View
Hello dear colleagues / researchers/ teachers / please suggest the best book to teach graduate students about the course "agricultural and ecommerce" , thanks in advance.
10 September 2020 2,062 9 View
DEM is based on the dynamic relaxation. But we use this dynamic relaxation in FEM which is based on discretizing the continuum domain and assign the lump masses at the nodes. But, we don't do this...
02 August 2020 5,012 1 View
I have identified fungus isolates from the fruit surface by SSU +ITS+ LSU regions, such as : 1) Fusarium kyushuense , 2) Fusarium proliferatum ;3) Aspergillus aculeatus ;4) Aspergillus europaeus...
15 July 2020 5,573 2 View
The term miscibility refers to the single-phase state in thermodynamics. I do not mean the compatibility of different components. To determine the miscibility I know several techniques such as...
03 March 2021 4,107 4 View
hello. i am junior researcher. I received a comment from a reviewer that he could not find NMR data in my submitted paper. I had included the NMR graph with explanation and formula to calculate...
27 February 2021 734 4 View
Hello I'm currently working on a topic related to studying the anaerobic biodegradation of TPH in marine sediments. In this work, sediment should be mixed with fuel oil to a concentration of 20 g...
24 February 2021 9,839 3 View
Please suggest solubilisation of chlorobutanol in injections. Tried pH and high temperature. But the issue is of assay drop. If anyone can suggest any solution. Its a commonly used excipient for...
21 February 2021 7,397 1 View
Hello, I have read in a few publications that to extract total DNA from sputum samples, both bead beating and enzymes are used to disrupt the cells. Bead beating is supposed to be efficient in...
18 February 2021 3,360 2 View
I am searching for thee database which could provide me signal sequence specific to the various cell organelle. such as signal sequence for mitochondria, signal sequence for endoplasmic...
04 February 2021 6,650 2 View
Hello dear researchers I want to use a thermal imaging camera to livestock study. I wonder which type to use. If you know or used a good type please comment or insert its online link in...
29 January 2021 4,163 4 View
In lattice modeling of RC structures, what is the mathematical concept behind choosing the cross-sectional areas for the simulation of, for instance, beams? Besides, seemingly, simulating the...
26 January 2021 2,638 2 View
If we make fragmentation in a long video, we can get several parts or Learning Objects (LOs) from the video. In such a case, how the system can gather all comments from all participants? At the...
07 January 2021 4,757 3 View
I understand that there might be huge differences between LogD and LogP for ionizable compounds. Normally, logD should be lower than logP for ionizable compounds. But can LogD value be...
05 January 2021 6,714 0 View
