Hello everyone.
I am working on Aspergillus sp., so I ordered primer specific to the Aspergillus genus targeting ITS1 and ITS2 markers. I tried the primer on a positive control and one of the isolates that confirmed by morphology that they are one of the Aspergillus species.
Unfortunately, the band (595-600bp) was seen in the positive control but not in the chosen isolation.
PCR conditions :
94oC -5min
94oC-1min
58oC-1min
72oC-1min
72oC-10min
35 cycles
It could be the amount or quality of your dna that is the problem. How much (in ng) dna are you amplifying and what is its OD260/280 ratio?
Paul Rutland The concentration 179.7ng and purity 2.08, I used it directly without any dilution.
180 ng in a pcr is rather high for template dna and you run the risk of having pcr inhibitors present in the dna Manal Abdullah Al-musa but more worrying is the high OD ratio. 1,8 is the maximum for dna but a value of 2 suggests that most of your dna is actually RNA
You can test differents dilutions of your DNA in PCR. Do the same with your control. I use 25ng of DNA in 12ul PCR mix
Paul Rutland Guy Longepied Thank you very much for your response. I usually use these concentrations and purity with all primers and they work, but one of the primers for Aspergillus niger doesn't work, do you think it's because I should dilute the DNA first?
if other primer sets are working with the Asp N dna then I would test whether these primers are degraded by running both old and a new aliquot of primers on both this and another dna sample that should work It is possinle that you have a polymorphism under the 3' end of one primer so you could try an amplificatiom at an annealing temperature 6c lower than you are currently using and see if this gives a product even a dirty one Manal Abdullah Al-musa but I would try the dilution experiment first
Paul Rutland Unfortunately, none of the primers I tried for Aspergillus N worked, but primers for Aspergillus flavus worked without dilution. So I'll start with a dilution experiment. I think Aspergillus niger produces a lot of secondary metabolism that could be PCR amplification inhibitor.
Are you sure that the dna that you are analysing is really Aspergillus Niger Manal Abdullah Al-musa ?. A good positive control of Aspergillus N is very useful in this sort of troubleshooting
Paul Rutland actually i am not sure 100%,but who gave it to me said it was Aspergillus niger , so I decided to use it as positive control,
Today, i did the dilution experiment and there were no results.
The PCR Program:
95C for 5 min
94C for 50s
56C for 0:30s
72C for 1min
72C for 7min
Primer sequence:
Foreword:-GATTTCGACAGCATTTTCCAGAA
Reverse: AAAGTCAATCACAATCCAGCCC
I would ask around other researchers to find another A. niger dna. It really is important to have good dna of the right type when setting up pcrs and for control samples in your future assays. It might be necessary to buy s sample commercially Manal Abdullah Al-musa . Your pcr parameters look fine for primer annealing so either the primers or the dna is a problem and it sounded like your primers are new
As Paul says, reliable control DNA is critical when troubleshooting PCR.
I'd buy some from a culture collection. CCUG (Culture Collection of the University of Gothenburg) in Sweden offer quite a range of microbial DNA.
- Badges
- Science method