Dear Maulik

Reverse transcription polymerase chain reaction (RT-PCR) is one of the many variants of polymerase chain reaction or PCR. This laboratory technique is widely used in molecular biology in order for the scientists to produce multiple copies of a particular DNA sequence through a process coined as “amplification.” The difference of RT-PCR from traditional PCR is that RNA is first transcribed in reverse into its DNA complement which utilizes the reverse transcriptase. The new complementary DNA containing the reversed transcription will then be amplified using the traditional PCR or real-time PCR.

Most students studying this process often make a mistake of interchanging reverse transcription PCR and real-time PCR as the two are abbreviated similarly. To avoid confusion, biologists label the real-time PCR as quantitative real-time PCR or qPCR.

QPCR differs greatly from RT-PCR because the qPCR is responsible for measuring the amplification as it occurs. It can be said that RT-PCR starts the amplification process while the qPCR measures it as the procedure takes place.

please visit this link

http://www.differencebetween.net/science/difference-between-rt-pcr-and-qpcr/

Difference Between RT-PCR and QPCR | Difference Between | RT-PCR vs QPCR http://www.differencebetween.net/science/difference-between-rt-pcr-and-qpcr/#ixzz2z94WYbV1

Dear Maulik

Reverse transcription polymerase chain reaction (RT-PCR) is one of the many variants of polymerase chain reaction or PCR. This laboratory technique is widely used in molecular biology in order for the scientists to produce multiple copies of a particular DNA sequence through a process coined as “amplification.” The difference of RT-PCR from traditional PCR is that RNA is first transcribed in reverse into its DNA complement which utilizes the reverse transcriptase. The new complementary DNA containing the reversed transcription will then be amplified using the traditional PCR or real-time PCR.

Most students studying this process often make a mistake of interchanging reverse transcription PCR and real-time PCR as the two are abbreviated similarly. To avoid confusion, biologists label the real-time PCR as quantitative real-time PCR or qPCR.

QPCR differs greatly from RT-PCR because the qPCR is responsible for measuring the amplification as it occurs. It can be said that RT-PCR starts the amplification process while the qPCR measures it as the procedure takes place.

please visit this link

http://www.differencebetween.net/science/difference-between-rt-pcr-and-qpcr/

Difference Between RT-PCR and QPCR | Difference Between | RT-PCR vs QPCR http://www.differencebetween.net/science/difference-between-rt-pcr-and-qpcr/#ixzz2z94WYbV1

Dear Maulik,

Which exactly kit do you use? Do the kit need RNA or Reverse-Transcribed DNA?

As template do you use RNA or Reverse-Transcribed DNA?

Are the Primers that you use suitable and tested for you target?

These are some of the questions that you have to find the answers in order to solve your problem.

Good Luck,

Maulik, if you give us more information about what you have done: methods/ kits used, controls tested, PCR program etc. we may be able to advise. There are many potential pitfalls in realtime PCR

I isolate DNA form Sputum sample using Alcohol:NAOH methods, with Spin column technology. The same DNA i used for RT PCR for just screening purpose. RT PCR, i am not using any KIT, but i prepared my on master mix (dNTPs (10mM) , Taq Pol, Taq Buffer (with MgCl2), Primers (5 µM) & Probe (5 µM), Water). But i am facing problem with results. I attached file of my results. RT PCR machine SmartCyclar 2 (cepheid).

Looks like you are having some problem with the dye(s). You might want to check the PCR product on gel to verify you are making any product.

Maulik,

you have to give us information about the probe that your are using. any fluorescent dye(s) on your primers?

Also, Tm of your primers and the exact conditions of your PCR.

I am using following Primers and Probe for RT PCR.

1-Primer F: GGGAAACTGGGTCTAATAC (19) HPLC

2-Primer R: CACCAACAAGCTGATAGG (18) HPLC

3-Probe: [6FAM] CGGGCTCATCCCACACCGCTA [BHQ-1] (21) HPLC

what is the program that you use performing Real-Time PCR?

Initial : 95 C (120 sec)

Cycle : 95 C (10 sec), 55 C or 60 C (30 sec), 72 C (30 sec) (45 cycle)

Final : 72 C (60 sec)

Try an annealing temp of 52 C. The final step do not needed. when does the Real-Time machine measure the fluorescence?

At 55 C Optics on, so it measure the fluorescence at 55 C.

For taqman probe to fluoresce, you need to measure after extension of the primer so 55oc would not be high enough. 72oC is too high. Normally a two step program is used 95oC (denature) 60oC anneal and extend then read fluorescence. You should firstly check that your primers are giving a product on a gel.

Primers gives very good product in gel, as i performed normal PCR for the same primers.

I already tried two step cycle , but facing the same problem,. One more thing i would like to know is that, i am using IMP (30%) + 2% NaOH for sputum sample processing . so can IPA inhibit the Amplification reaction or block PCR?

If you are finding a product when you run PCR sample on the gel then your DNA template is good. I presume you are purifying the DNA with phenol- chloroform and ethanol precipitation to remove anything that may interfere with PCR so you don't need to worry about NaOH etc. You could run the sample on the gel after running in your realtime machine to check everything is OK with the machine. That would suggest something is wrong with your taqman probe or your machine is not set up to read fluorescence correctly. Do you have another gene to check such as a control gene also with taqman probe to check the machine? If machine is OK, next to look at your probe. Did you design yourself or are these primers and probes published? I would guess TB detection by taqman would be a well established technique and publications would have the PCR conditions in the materials and methods. If it is still not working then I would suspect a problem with the probe and have it resynthesised.