I have done a gradient PCR (55-70 degree) using Forward primer GAATTCCATATGCAATCTACTAAAAAGGCA and reverse primer TATCTCGAGTTACACGATAAAGTCCGTGGC using .4um of primer concentration and 17 ng of template DNA for amplification of my 1.5 kb gene product. It successfully amplified but due to some mistakes I had to change my primers and when I used new primer sets forward (ACAAACTACCATATGCAATCTACTAAAAAGGCA) and reverse (TATAAGCTCGAGTTACACGATAAAGTCCGTGGC) with the same genomic DNA I am not getting any amplification at various temperature.
The image of previous primers are as below showing amplification at 57.9 and 55 degree. However I am not able to upload image for agarose gel electrophoresis for new one.
Dear Vishal,
What exactly you are looking for???
These both primer pairs are different...
Which gene you intend to amplify?
Recheck your primer....
Go for another set of primers..
Try for Nested PCR by selecting internal primers...
All the best.
Hi, i just analyzed your new reverse primer for potential self-annealing sites, and it has one. that could be causing the reverse primer from being unavailable for amplification. Redesign and keep Annealing temps high. use this tool to calculate parameters and also check the potential hairpins and self annealing sites using the "check self complimentarily"button on the lower right hand of the screen. Hope this helps http://www.basic.northwestern.edu/biotools/oligocalc.html
question is i used the same complementary part in both set of primers and same restriction site just changed the 5' overhang but second set is giving no amplification. i am in search of possible answers.
@RAHUL rOY sIR THE HAIR PIN FORMING set of primers worked fine its another one thats not working.
2Ashish Sir. If you closely observe both set of primers they intend to amplify the same gene contain the same restriction site only have difference in 5 prime over hang which is in previous set is 6 base pair and in next set - 9base pairs.
You may have some problems with the primers themselves. Have you run your sequences through https://www.idtdna.com/analyzer/ and checked for self-dimerization and heterodimerization? For your forward primer there is a significant homodimer that worries me @ -7.82 kcal/mole
AAAAA is not good, also A at the end. Try to design primer with less same nucleotids one behind another and also with minimum one C or G at the end. Better is two of them. Also the melting temperatures should be not so far away from each other.
HI, maybe this is also helpful: http://oomyceteworld.net/protocols/primer%20designing2.pdf
https://dnacore.mgh.harvard.edu/cgi-bin/sequencing/PCR_Primer_Design_Guidelines.htm
Cheers, Nadine
@artur Sir, Its a protein from Prokaryotic organism and the polyA track is in the open reading frame of gene to code specific amino acids. I dont want to remove the restriction sites and off course these primers are really crapy but i dont have any other option. The modification possible is only to change restriction sites or 5 prime overhang sequence. However i solved this problem, primers were ok the problem was the Genomic DNA concentration, which by mistake i added too more than required. Thanks for everyone paying attention and giving ideas, i learned a lot which surely help me in my future projects.
- Badges
- Science method