14 Questions 38 Answers 0 Followers
Questions related from Vishal Srivastava
I am trying to purify one of my protein of interest having molecular weight around 52 Kda. Upon over expression it comes in inclusion body. So I isolated and washed inclusion body and then...
08 August 2017 6,808 10 View
Recently i got for N-terminal sequencing of my three different protein samples and got results in form of a table. the sequence predicted is quite different from what we already checked through in...
08 August 2017 9,837 0 View
Actually i am trying to express and purify a microbial metalloprotease. I successfully developed the construct and cloned it in E.coli cells and the protein got expressed in form of inclusion...
07 July 2016 9,193 3 View
Hi, My name is vishal and excuse me if this post looks like an endorsement to you. You are free to leave it and ignore. Actually i with my two seniors thought of creating an alternate platform to...
03 March 2016 2,607 0 View
Dear friends , i am in urgent need of a plasmid construct- pRuW4inh1 harboring the Erwinia chrysanthemi secretion system. The plasmid was originally constructed by by prof. C. Wandersman, of...
03 March 2016 7,996 0 View
I am purifying my protein under denaturing condition and washing the inclusion bodies before with washing buffer (50mM Tris, NaCl-500mM, Urea-2M, Triton X-100- 1%, pH-6.8) and Suspension buffer...
12 December 2015 5,101 6 View
I am trying to purify protein having molecular weight ~50Kda under denaturing condition through Ni-NTA chromatography and got following profile. Any suggestion to stop protein coming in flow...
06 June 2015 6,235 15 View
My cloned gene in pET23b contains a C-terminal his tag and mature form of protease. Its not getting expressed in e.coli cells. Even after transformation very little colony forms ~1-5 colonies...
02 February 2015 7,151 8 View
I am working with a protease gene which is his-tagged at c-terminal and is ~50Kda size. I transformed the recombinant construct (pET23b+Gene) in Rosetta DE3 pLysS. When I am trying to check...
01 January 2015 9,093 10 View
I successfully cloned a gene and checked it by colony pcr and restriction digestion. There after I transformed the construct in E.coli DH5alpha for plasmid prep and isolated sufficient amount of...
09 September 2014 4,559 8 View
I had performed restriction digestion of insert and vector for 3 hours and gel extracted them using a qiagen gel extraction kit in 60 ul of nuclease free water. Thereafter I tried to measure the...
08 August 2014 7,698 11 View
Hello everyone, I prepared my vector (pET23b) and got 10.5ug of Vector dissolved in 150ul of nuclease free water and the insert is about 11 ug in 100ul. i wanted to perform a double digestion on...
07 July 2014 2,378 5 View
I had done PCR amplification of my gene of interest using bacterial genomic dna as template. Further gel extraction (thermo scientific) of 200ul pcr reaction volume had given pcr product having...
06 June 2014 7,722 17 View
I have done a gradient PCR (55-70 degree) using Forward primer GAATTCCATATGCAATCTACTAAAAAGGCA and reverse primer TATCTCGAGTTACACGATAAAGTCCGTGGC using .4um of primer concentration and 17 ng of...
06 June 2014 1,074 9 View