Primers used by Joycee et al, 1994 are good enough to produce ITS regions.  But now days multigene sequence analysis is used for identification of nematodes. You can also follow the protocol as suggested by Vrain et al.

Dear Houda Kawas, mainly following regions of taxonomic importance are used for identification nematodes

Primer Sequence 5'–3' Reference

TW81 (ITS)  GTTTCCGTAGGTGAACCTGC                   Joyce et al. (1994)

AB28 (ITS)  ATATGCTTAAGTTCAGCGGGT                    Joyce et al. (1994)

5.8SM2  CTTATCGGTGGATCACTCGG                        Zheng et al. (2000)

5.8SM5  GGCGCAATGTGCATTCGA                                Zheng et al. (2000)

D2A (28S)   ACAAGTACCGTGAGGGAAAGTTG                      De Ley et al. (1999)

D3B (28S)  TCGGAAGGAACCAGCTACTA                                    De Ley et al. (1999)

The above primers can be helpful in identification of H. schacthi.

Dear Aashaq Hussain Bhat

Thanks for your efforts.

Best regards

Houda Kawas