there are several researcher used many primers.
Primers used by Joycee et al, 1994 are good enough to produce ITS regions. But now days multigene sequence analysis is used for identification of nematodes. You can also follow the protocol as suggested by Vrain et al.
Dear Houda Kawas, mainly following regions of taxonomic importance are used for identification nematodes
Primer Sequence 5'–3' Reference
TW81 (ITS) GTTTCCGTAGGTGAACCTGC Joyce et al. (1994)
AB28 (ITS) ATATGCTTAAGTTCAGCGGGT Joyce et al. (1994)
5.8SM2 CTTATCGGTGGATCACTCGG Zheng et al. (2000)
5.8SM5 GGCGCAATGTGCATTCGA Zheng et al. (2000)
D2A (28S) ACAAGTACCGTGAGGGAAAGTTG De Ley et al. (1999)
D3B (28S) TCGGAAGGAACCAGCTACTA De Ley et al. (1999)
The above primers can be helpful in identification of H. schacthi.
Dear Aashaq Hussain Bhat
Thanks for your efforts.
Best regards
Houda Kawas
What is the opinion of our dear colleagues on the development of the methods of listing research by presenting research with our names periodically instead of manually inserting them?
11 December 2018 1,515 3 View
What are the best plant extracts used to protect fruits from post-harvest diseases?
06 July 2018 6,661 30 View
What are the priorities for developing agricultural scientific research in developing countries?
06 July 2018 1,345 24 View
03 April 2018 6,067 2 View
04 May 2017 6,474 4 View
01 February 2017 6,745 7 View
06 July 2016 1,932 4 View
Several assumptions.
04 May 2016 6,728 1 View
04 May 2016 1,574 3 View
Uresiphyta spp. as pest of several plants, the main parasite to control this pest may be a solution to stop using insectisides.
04 May 2016 9,624 2 View
I have a dataset with about 80 different species. As usual, some species are very easy to identify with certainty whereas others are more difficult, which means that I am less certain of my...
03 March 2021 8,066 4 View
I am searching for a good place for the Post Doc,
02 March 2021 4,053 3 View
So, I have been trying to run a pACYC PCR which will be used later on for a Gibson Assembly. However the PCR is not working. I have already tried gradient PCR and changing extension time; however...
02 March 2021 1,146 2 View
I want to find a quorum sensing inhibitor from plant extracts. Klebsiella pneumoniae, Moraxella catarrhalis, Staphylococcus aureus, and Streptococcus pneumoniae. I looked for these strains...
01 March 2021 7,675 3 View
I have to amplify a gene and my primers just reached. The Tm for Forward primer is 64.2, and that of reverse primer is 65.5. Can some one suggest how to get the best annealing temperature? Thanks...
01 March 2021 360 7 View
Dear Dr. Cai, my name is Simone Prospero and I work in the team of Phytopathology at the Swiss Federal Institute for Forest Snow and Landscape Research (WSL;...
01 March 2021 1,133 1 View
Hi, I'm looking for data (mainly related to management: growth rate, canopy size, soil and climate preferences, etc.) about tropical trees used in tropical agroforestry. Have you ever heard about...
28 February 2021 7,356 8 View
The resultant solid was partitioned three times with 250 ml of petroleum ether (40-60/c) to remove any fatty material and evaporated to dryness.
28 February 2021 9,464 2 View
I am trying to identify these 3 genes among some tomato cultivar collections and after aligning some sequences from NCBI, I couldn't find unique sequences to target for specific primers. There...
28 February 2021 606 3 View
hello everyone, I need to do standard curves for my qPCR, what is the ideal efficiency range? I tried a primer (Mglu2 receptor) that gave an efficiency of 90.2%. Is it accepted?
28 February 2021 1,254 3 View