What is the ideal concentration of chitosan used for encapsulating yeast cells?

More Surajvanshikumar Suvarna's questions See All

How to apply Hiddem Markov model for DNA sequence ?

Good morning to all if i have following random DNA sequence then how to find intron and exon manually for Hidden Markov model...

03 June 2023 5,447 2 View

Regarding intron and Exon in DNA sequence?

For example i have hypothetical small DNA sequence with 30 bp i.e AGCTTGGCAATCGGTAGGCTAGATCGTACCT. Now i want to count how many transitions between Intron, Exon and Splice site manually. can...

19 April 2023 3,766 5 View

HIdden Markov model?

How to train HMM in R. i tried with depmixs4 but show error for my data.

08 April 2023 3,023 2 View

Example for LHMM?

Can anyone give me the numerical example for Layered Hidden Markov Model Layer should be grater than or equal to 2. Thankyou

19 March 2023 7,350 3 View

Best software for drawing Markov plot?

What is best Software or website to draw Transition diagram or Markov plot freely Thankyou

13 March 2023 3,397 1 View

Regarding Markov chain when data is binary?

Hello Everyone, For example i have 3 states Markov model i.e Healthy, Sick and Death. i collected data in the last year. data form is like yes or no for each. Simple example is Healthy state...

18 December 2022 6,063 4 View

Regarding Diabetes chromosomes ?

which chromosome affected diabetes(chromosome 6 ?) or any other also. and also suggest me where i can get chromosomes list wise diseases and gene Thankyou

03 December 2022 7,549 7 View

Regarding DNA sequence?

Good morning, How to predict next generation DNA sequence by Hidden Markov model. I read some material about but unable to get for example my random sequence is ATCGAAGTCCCGGATCGATGA from this...

02 November 2022 6,567 3 View

Regarding DNA sequence, how to know?

i want to know how to find intron and exon in DNA sequence let my sample be CTGTTGGTGCAATGCCACGGAGACATGGGTGACCTATGGAACATGTTCTCAAACTGGTGAACACCGACGA Thankyou

27 October 2022 140 2 View

How to convert Intensity (V/MicroAmps) in to Intensity(CPS/MicroAmps) unit in emission spectrum?

While recording emission spectrum the Y axis will show the unit Intensity(CPS/MicroAmps).I recorded spectrum in IR range where the unit showed as Intensity (V/MicroAmps).How to interconvert this?

15 August 2022 8,548 0 View

Is there any way to quantify bacterial and fungal cells in their mixed culture?

I am working in fungal fermentation of soybean meal and there is bacterial growth in them at times. I am trying to quantify fungal cell counts and bacterial cells; but I haven't been able to do at...

07 August 2024 7,535 4 View

How can we differentiate between calcite, dolomite, siderite, magnesite and ankerite minerals in carbonatite rocks in thin section under op microscop?

How can we differentiate between calcite, dolomite, siderite, magnesite and ankerite minerals in carbonatite rocks in thin section under optical microscope?

07 August 2024 2,132 3 View

Why activated CAR-Jurkat cell could not kill targets?

Previously when I co-coluture anti-CD19(FMC63) CAR-Jurkat with Raji with E:T=5:1, Jurkat can eliminate Raji in 24h. However, when I test another CAR construct, although I can dectect totally CD69...

06 August 2024 641 2 View

How much Yeast should we add to fermentation media?

I have prepared a liquid broth containing Yeast (S. Cerevisiae) that i need to add from it to fermentation media of lignocellulosic hydrolysate. I need to know based on what parameters do we add...

06 August 2024 662 1 View

How much total RNA concentration to be extracted from sorted plasma cells from bone marrow of C57BL/6 mice for RT-PCR ?

i have sorted anti-NP specific plasma cells from bone marrow of C57BL/6 mice at certain times after immunization with variable counts and isolated total RNA using TRIZOL method for RT-PCR using...

05 August 2024 8,835 1 View

XRD Analysis is showing only Calcium carbonate. It is not showing other compounds. Can anyone help me get the other compounds?

XRD Analysis is showing only Calcium carbonate. It is not showing other compounds. Can anyone help me get the other compounds

04 August 2024 3,019 3 View

How to use Density Functional Theory to calculate carrier mobilities of solid system?

Hello, everyone. I have tried to determine carrier motilities of some materials, by Density Functional Theory, using Quantum ESPRESSO. There are a few methods to do it, like a package called...

04 August 2024 8,894 1 View

Does long-term culture of murine Monocytes result in macrophage differentiation?

Hi, I am isolating monocytes from the bone marrow using the Mouse Monocyte EasySep kit. I want to treat these cells and monitor expression of specific markers over the course of 10 days. I will...

04 August 2024 7,282 2 View

Can i quantify a nanoparticle encapsulated in cell culture medium by hplc?

Hello, if you made a transwell assay where you incubate the cells with a nanoparticle-encapsulated drug and considering that in the oposite compartment you'll have both the free and encapsulte...

03 August 2024 2,730 1 View

Does anyone have issues using Prepman Ultra reagent for MicroSeq ID bacterial, fungal and yeast sample preparation?

I have been attempting to extract DNA from Bacterial, Fungal and Yeast banked samples (>1e7 cells) using Prepman Ultra reagent and I seem to be struggling to obtain a sequence. Although the...

01 August 2024 2,079 0 View

Jakia Sultana Jothi

You may get some idea from this paper.

http://www.tandfonline.com/doi/pdf/10.1080/13102818.2014.910373