I would like to ask whether anybody can offer the best universal primer for genus bacterial identification??
Most widely used marker is 16S rRNA gene and amplified by 27F and 1492R primer set.
27F AGAGTTTGATCCTGGCTCAG 1492R GGTTACCTTGTTACGACTT
Dear Wong Ling Chie
Have you checked this primer for G+ve and G-ve??
Air moisture harvesting Air water collection devices
06 August 2024 5,473 2 View
Hi everyone I need a file with a dirty and clean potato image
04 August 2024 7,199 4 View
Molecular docking software/ websites?
02 August 2024 8,704 7 View
Can we patent a process flow diagram developed using a process simulator but no actual cases is carried out? For example consider a process for certain product manufacture where a new process flow...
31 July 2024 781 1 View
I am working on algal extract to which gas chromatography (Not GC-MS) spectrum I want to discover. My question is can we identify specific compounds using retention time if I compared the RT with...
29 July 2024 8,034 4 View
I want to write a topic for my PhD thesis in hospitality (hotels), can u please suggest some variables
29 July 2024 9,058 3 View
Time-Frequency Domain
19 July 2024 8,031 2 View
Dear Colleagues, I hope this message finds you well. My name is Noor Al-Huda K. Hussein,and I am a researcher specializing in deep learning applications in genetic data analysis. I am currently...
18 July 2024 5,562 0 View
Dear Colleagues, I hope this message finds you well. My name is Noor Al-Huda K. Hussein, and I am a researcher specializing in deep learning applications in genetic data analysis. I am currently...
16 July 2024 3,981 6 View
I am currently testing the effect of bacterial filtrates on cancer cells , after seeding the cells I tested the bacterial filtrates against them , and got images of all 96 wells using inverted...
10 July 2024 7,145 2 View
This larva was captured using a plankton net in the Persian Gulf during the summer. I believe it may be a Facetotecta nauplius.
08 August 2024 3,746 4 View
After performing symmetric PCR, PCR purification was performed. Afterwards, asymmetric PCR was performed using the PCR purification product as a template, but no ssDNA band was confirmed in the...
08 August 2024 1,668 3 View
I am working in fungal fermentation of soybean meal and there is bacterial growth in them at times. I am trying to quantify fungal cell counts and bacterial cells; but I haven't been able to do at...
07 August 2024 7,535 4 View
I want to introduce a point mutation (change in one nucleotide) into my gene of interest (DNA binding domain) I have designed primers as recommended on the Data sheet of the kit : -Both primers...
05 August 2024 9,059 3 View
How to design VN primer to attach with universal reverse primer
05 August 2024 2,116 3 View
Hi I am working on data driven model of the microgrid, for that, i need the reliable datasets for the identification of MG data driven Model. Thanks
02 August 2024 5,748 4 View
Given that the bacterial genome has over 800 contigs, but its quality metrics are good, with a completeness of 98.55% and a contamination of 0.68% as assessed by CheckM, what specific validation...
01 August 2024 1,514 1 View
It's an end-point PCR protocol. I'm using 1.5% agarose gel with SyBR Safe dye and TBE as a running buffer, visualization on BioRad XR+ system. I was primarily thinking of primer efficiency,...
01 August 2024 4,673 4 View
Hello everyone, I performed a PCR yesterday, and the results showed no bands on the gel. Of course, I probably missed some crucial steps, like adding my samples to the PCR strips themselves, for...
31 July 2024 2,406 6 View
Hello all, I have been trying to follow a 2-stage PCR protocol used to amplify barcodes of a large yeast library, as per Nyugen et al. (2022) -...
30 July 2024 841 2 View