I would like to ask whether anybody can offer the best universal primer for genus bacterial identification??
Most widely used marker is 16S rRNA gene and amplified by 27F and 1492R primer set.
27F AGAGTTTGATCCTGGCTCAG 1492R GGTTACCTTGTTACGACTT
Dear Wong Ling Chie
Have you checked this primer for G+ve and G-ve??
Light is inevitable for the process of photosynthesis reaction. Naturally sunlight plays the vital role for this process. Light may be of different colours like white, red, yellow, blue etc....
02 March 2021 7,890 2 View
during ultrasound examination of acute abdomen, sometimes we see free fluid , can we know the type of fluid ,whether blood or not , using ultrasound only? if yes , what are the sonographic...
01 March 2021 7,476 4 View
There are different kinds of food stuffs which we intake daily according to our requirements. Carbohydrate, protein, fat, mineral, vitamin, water are mainly working for the growth and development...
01 March 2021 831 2 View
Is the period to autoclave not enough? The inoculation in a hood and flame and UV and alcohol.
27 February 2021 9,356 3 View
I need to be able to match in-text citations to a reference list and back again in very large documents (100+ pages) WITHOUT the use of referencing software like Endnote. my method is to type the...
27 February 2021 9,848 1 View
I want to publish paper in journal but I have figures which have drawn with bio-renders, can I put them in the paper or which other software I can use to draw them?
27 February 2021 8,179 1 View
What is the most suitable medium of ascomycetes fungi ??
26 February 2021 4,413 1 View
Using GDB, it is straightforward to debug and monitor a target program by setting a break-point at a specific instruction, since the instruction addresses are known. However, we have two...
24 February 2021 1,598 2 View
Hi everyone, I am just wondering if we incubated 200 microliter of whole blood with 50 microliter of cancer cells(1bout 5000cells) do you think that cancer would survive for 48 hours?
23 February 2021 3,840 3 View
Detecting the drug related problems is an important step in the pharmaceutical care plan
21 February 2021 5,421 3 View
I have a dataset with about 80 different species. As usual, some species are very easy to identify with certainty whereas others are more difficult, which means that I am less certain of my...
03 March 2021 8,066 4 View
So, I have been trying to run a pACYC PCR which will be used later on for a Gibson Assembly. However the PCR is not working. I have already tried gradient PCR and changing extension time; however...
02 March 2021 1,146 2 View
I have to amplify a gene and my primers just reached. The Tm for Forward primer is 64.2, and that of reverse primer is 65.5. Can some one suggest how to get the best annealing temperature? Thanks...
01 March 2021 360 7 View
I am trying to identify these 3 genes among some tomato cultivar collections and after aligning some sequences from NCBI, I couldn't find unique sequences to target for specific primers. There...
28 February 2021 606 3 View
hello everyone, I need to do standard curves for my qPCR, what is the ideal efficiency range? I tried a primer (Mglu2 receptor) that gave an efficiency of 90.2%. Is it accepted?
28 February 2021 1,254 3 View
Is there any book chapter/book, webpage or research article available to understand genome-wide gene identification?
28 February 2021 8,095 1 View
Dear All, mirna primer showing some problem in the melting curve? any idea why? As attached is the melting curve. The forward sequence is obtained from miRBase and reverse primer is universal.
28 February 2021 5,008 4 View
Hello researchers, Hello Castalia3.2 researchers I am a beginner with Castalia, I work on optimization of RFID systems used in wireless body networks. I simulated a WBAN with 10 nodes and one...
28 February 2021 400 1 View
based on what I've studied on multiple papers, for peptide and protein identification Alpha-cyano-4-hydroxycinnamic acid (CHCA) is an appropriate matrix to use, I also know that the CHCA powder...
26 February 2021 6,799 3 View
Hi I am a bit confused. They are asking me to find out the volume of DNA required in ul (a total of 30-100 ng for genomic DNA) from the DNA concentration in the nanodrop reading which was 404.8...
26 February 2021 5,029 2 View