What happens to proteins in a crude tissue lysate when homogenized in ice-cold 50 % aqueous methanol?

24 February 2022 0 5K Report

I have to use ice-cold 50 % aqueous methanol to lyse tissue. After centrifugation, the proteins will be in precipitate or in solution or both?

Badges
Science topic

Similar topics
Correction

More Khawar Sohail Siddiqui's questions See All

Forecasting with known copula parameters?

I want to calculate the Mean absolute percentage error (MAPE) for my copula model. I am stuck at the forecasting step. I am not specifying the copula here for different data pairs. 1. I have two...

14 July 2024 7,604 1 View

If Concentration of DNA is 85ng/ul then calculate its concentration for 50ul reaction using Phusion Flash Master Mix?

can any budy explain how i calculate the DNA concentration for the 50ul reaction?

22 May 2024 9,557 1 View

If the sequence of the primers are given and size of the PCR product is 2500 then what will be the PCR profile for the given reaction?

If the sequence of the primers are given as: Forward: ATATAGACCAATATTCCTGTTAGCA, Reverse: AAAAATTAGCCGGGCGTAGTGGCG and size of the PCR product is 2500bp, then what will be the PCR profile for the...

22 May 2024 7,777 1 View

How to generate data from copula parameters for forecasting and model comparsion?

Hi, I have parameters of time-varying normal copula. Now I want to forecast using these parameters. For that I will need to generate data using these copulas parameters as shown in the...

20 May 2024 488 0 View

How can i check whether urea/denaturant has been removed from my protein after dialysis ?

i am refolding protein by gradient dilaysis in which i gradually decrease concentration of urea by gradient dialysis. however im not getting surety wheather denaturant has been completely removed...

24 April 2024 5,399 1 View

For copula modeling of time series data, why are standardized residuals of fitted ARIMA/GARCH required instead of directly using time series data?

Hello, I have read that for standard copula modeling, you can get empirical cdf of data and use it for copulas. But for time series data, we must first fit ARIMA/GARCH, get standardized...

11 February 2024 2,463 1 View

Time Varying copulas Empirical analysis steps?

Hello, All papers I have read about time-varying copulas just produce tables, but none explains exact steps for empirical data. How do I calculate the time varying parameters for the copula? I...

18 December 2023 5,453 1 View

Can someone please suggest me a protocol for Electrophoretic mobility shift assay (EMSA)?

I have to check that whether my purified protein interacts with DNA for which i need to perform an EMSA. I am unable to design this experiment properly so need some tips and suggestions. Thankyou...

04 December 2023 3,864 0 View

Can someone explain that why my 0.7% agarose gel takes 2 hrs to run and also some suggestions on cloning for bacterial two hybrid experiment?

I am doing cloning of a big bacterial insert (3705bp) into a vectors of varying sizes ranging from 3017bp to 3469bp for my bacterial two hybrid experiment. Among other problems with my cloning I...

15 November 2023 7,101 4 View

How to prepare the Torodial shape sample of Mechanically Alloyed FeCoNiAlMn1-xCrx High Entropy Alloy Powders?

I have 6 different powder samples of Mechanically Alloyed magnetic High Entropy Alloy Powders as FeCoNiAlMn1-xCrx (x=0,0.2,0.4,0.6,0.8,1). I need to measure there microwave absorption properties...

24 July 2023 3,412 0 View

Microtome tissue sectioning - How to prevent chatter of paraffin tissue specimen sections?

Hello everyone, I have recently started using the microtome device for sectioning of paraffin-embedded mice lung. While I had some success in sectioning and observing proper ribbons, some of my...

06 August 2024 666 4 View

Do you have good tips for seaweed tissue preservation in the field for post RNA extraction?

I will be with my students collecting seaweed samples in a marine farm and later we will process this tissue for RNA isolation and further sequencing. Does anyone have tips on how to collect the...

04 August 2024 501 2 View

Request a single Lecture notes for math as detailed as this that I can find in one place?

- The Existence/Uniqueness of Solutions to Higher Order Linear Differential Equations - Higher Order Homogenous Differential Equations - Wronskian Determinants of $n$ Functions - Wronskian...

03 August 2024 2,366 0 View

How to Transform my handy-wavy explanation of why group I/II metals oxides in aqueous solution are basic into a rigorous argument?

I heard an explanation about something being a better proton acceptor or lone pair donor but that doesn't make sense. I couldn't explain in in terms of acid-base theory. The hand-waving way I saw...

03 August 2024 9,918 0 View

PBMC infection with virus?

In my study, I intend to infect PBMCs with SARS-CoV-2. After that, I will analyze NK cells by flow cytometry to see if their phenotype changes or if they show degranulation. After the infection, I...

01 August 2024 4,403 4 View

What is the problem with these tissue culture plants?

All plants are green but some of these plants becomes yellow. I did not found any reason. Please help me to find out the real problem.

01 August 2024 589 4 View

Tissue homogenization in mouse with FastPrep-24™ 5G - is the D matrix system useful?

I need to lyse and homogenise mouse tissues. So far I have experimented with liver and lung tissue, using matrix D. The liver was completely lysed with 6 repetitions of the standard program, but...

31 July 2024 9,186 0 View

For the process of preparing decellularized matrices what is the ideal solution in which we can bring the tissue from slaughter house to lab?

I am planning to prepare a decellularized porcine tissue derived biomaterial. It would be very helpful if I get to know the composition of the solution which is ideal to bring the tissue sample...

31 July 2024 5,645 2 View

How to prevent hemolysis after performing cardiac puncture to draw blood from mice in serum?

We have encountered an issue with the serum of mice being hemolyzed after the process of centrifugation. Could you please provide guidance to prevent hemolysis ?

29 July 2024 8,402 4 View

Culture fibroblasts with or without FGF2?

I'm new to primary human fibroblast culture and I'm studying aging using cells from old and young donors. Some research groups have used media supplemented with FGF2, so I cultured cells in the...

29 July 2024 3,030 2 View