What causes these irregular amplification curves during qPCR (old instrument)?

09 March 2018 0 3K Report

I recently started running qPCR on an old Stratagene MX3000P in the common core facility and once in a while it spits out curves like this (see attached image) at me. Anyone encountered this problem before?

Badges
Science topic

Similar topics
Brachyura
Cancer

More Dennis Kolosov's questions See All

How to carry out micro preparation of Zn-2 (Zamak 2) sample surfaces?

I am currently struggling to achieve a good surface finish on mounted Zn-2 samples. Both grinding and polishing (with SiC, silica and diamond) resulted in embedding of the grinding/polishing media...

11 June 2024 2,055 0 View

FFPE mouse femurs appear to have internal bubbles?

I am wondering if this is a technical issue that occured during processing. I have murine femurs that were decalcified in 15% EDTA over 2 weeks and then processed and I embedded them into FFPE....

02 April 2024 6,382 2 View

Is it necessary to include an FMO for 7-AAD dye in your Flow Cytometry experiment? If not, why?

I'm optimizing a flow cytometer experiment and one of my three stains is a 7-AAD Live/Dead stain. The other stains in my experiment are staining for CD34+ and CD45+ cells. Is it necessary to...

01 April 2024 3,060 0 View

What is best way to get lowest adsorption site at subsurface of high entropy alloys?

I am currently studying diffusion of oxygen in high entropy alloys. I want to calculate the activation energy from an adsorption site on the surface to the subsurface. I placed the oxygen atom...

26 March 2024 3,268 0 View

Examples of gender norms that affect men and women's participation in agriculture?

It is a course unit called gender and social economic issues in development ARX 1201

07 January 2024 365 0 View

Anyone has a copy of Mack's work in Methods of Computational Physics 1965?

Hi, anyone can share the link for the full Methods of Computational Physics edited by B. Alder 1965, Vol. 4, or the particular Mack's publication inside? Thanks in advance.

25 November 2023 1,213 0 View

Is it necessary to to conduct independent simple regressions for a multivariate regression model or this can be derived from the multiple regres?

The objective here is to determine factor sensitivities or slope coefficients in a multiple ols regression model.

17 August 2023 7,825 5 View

Does anyone had problems installing Cytoscape in Ubuntu 22.04.2 LTS?

I am trying to install Cytoscape in Ubuntu 22.04. I followed the instructions on the official website and installed Java 11, 17 and 18. None seems to work. I had this error every time: Error:...

30 May 2023 9,889 2 View

Why is it that when I open a structure and I select atoms in Vesta it crashes immediately?

I am trying to work on a structure in Vesta. But after opening, it crashes when I select atoms to delete. Any help would be deeply appreciated

07 March 2023 5,805 4 View

Working primers for human NPC1 and TrkB qPCR?

For one of our experiments we are planning to run a qPCR on cDNA from human samples. In our first test, we found that our primers for TrkB (forward: ACAGTCAGCTCAAGCCAGACAC, reverse:...

24 January 2023 4,508 3 View

AUX gas reading problem on QE with full MS and PRM method in one run?

Dear QE-users, In the method where full MS positive mode and PRM mode are used, we always get an incorrect auxiliary gas reading (41 instead of 25). This only happens in this method; other...

06 August 2024 4,953 0 View

Are there any instruments for studying time similar to the way it is in space?

There are a huge number of methods for studying objects in space, according to the senses (and not only). Mechanical, thermal, optical, acoustic, electrical, magnetic, based on particle beams,...

06 August 2024 7,102 0 View

Weak DAPI staining after immunohistochemistry - how to improve?

After immunohistochemistry of previously fixed in PFA and EtOH and then frozen 20 μm sections of zebrafish brain, DAPI staining is very weak (right) compared to the same sections stained without...

05 August 2024 9,637 2 View

People weight in Oaxaca Blinder Decomposition on R?

Hello guys! Do you have experience running a Oaxaca-Blinder decomposition on R applying person weights. How do you suggest doing it? I have a variable PERWT which gives more information on how...

04 August 2024 6,033 0 View

Dirty and clean?

Hi everyone I need a file with a dirty and clean potato image

04 August 2024 7,199 4 View

Hello, regarding Mxene 2D titanium carbide?

I fabricated Ti3C2Tx using concentrated HF 40%, I plot an XRD as attached image below.. please let to know if I obtained it or not.

02 August 2024 6,789 4 View

Is there any Indian Company or Startups, from any universiy or IITS, which manufacture Gas Chromatography instrument , i want to make a custOmized G?

or we can collaborate

01 August 2024 6,705 2 View

How to perform EEG source analysis on each trial of data separately?

Hello Everyone I have a question about structure for connectivity analysis on sources. My goal: preprocess and cut data into trials create headmodels, using template MRI file perform source...

30 July 2024 2,744 1 View

How to add Cr parameter in autodock?

When I run autogrid4 it says: autogrid4: ERROR: Unknown receptor type: "Cr" -- Add parameters for it to the parameter library first! Look forward to your reply.Thank you so much!

29 July 2024 488 0 View

IHC profiler in image j software. has anyone used it to quantify nuclear DAB positivity?

Dear researchers. I tried using the IHC PROFILER in image j to quantify nuclear DAB staining. I followed the instructions in the original article by "Varghese F, Bukhari AB, Malhotra R, De A...

29 July 2024 2,229 0 View