The low cost zebrafish brain structures measurement technique?

Dears we want to measure structural changes in zebrafish brain with a valid low cost instrument. what is your choice ?

18 November 2020 600 2 View

I'm working on a mesenchymal stem cells culture , I want to know roughly how many MSCs I can yield at passage 3 from a single rat bone marrow ?

I'm working on a mesenchymal stem cell culture isolated from rat bone marrow and I want to yield a specific MSCs count from passage 3 . I want to know the yield of cells in passage 3 to know how...

27 October 2020 396 1 View

What is the annealing and elongating temperature of a specific primer (31 bases) for reverse transcription (GAGTTCCAGGTCACTGTCACTGGCTCAGGGA) ?

GAGTTCCAGGTCACTGTCACTGGCTCAGGGA

02 August 2020 139 8 View

What is the annealing and elongating temperature of a specific primer (31 bases) for reverse transcription ?

what is the annealing and elongating temperature of a specific primer (31 bases) for reverse transcription ?

13 July 2020 7,601 3 View

Which methods could be used to determine the specific surface of fixed-bed and moving-bed packing media?

The methods/devices which could be used to determine the nominal and effective specific surface of fixed-bed and moving-bed packing media which have been used for biological wastewater treatment...

20 February 2018 8,818 2 View

What are the Mark-Houwink parameter values (K and a) for water-acrylamide copolymer system. Will be there any change with change in feed ratio?

I want to determine the viscosity average molecular weight of different acrylamide copolymers in water medium. I want to know the Mark-Houwink parameter values in water medium. If there is any...

27 November 2017 1,316 4 View

Does anyone familiar with nitrogen-based biocarriers which have been used in the MBBR process?

Dear respectful researchers Could you please provide me some information regarding the nitrogen-based bio-carriers which have used in the MBBR process. What are the main differences and possible...

21 August 2017 8,008 3 View

Does anyone knows the optimum condition for start-up MBBR process?

Dear Collegues I need the details condition for the start-up of the MBBR process for optimum situation, such as N and P concentrations, suitable feeding for microorganisms, BOD/COD ratio, F/M,...

06 August 2017 3,876 1 View

Recent works on optimal control of wind power plants?

Recent works on optimal control of wind power plants ?

10 October 2016 7,905 5 View

Can you give an example for a clinical Decision Support System in Dentistry with its link online?

I am searching for any type of clinical Support Systems or programs in Dentistry, present online or found as a free software online.

10 September 2014 9,137 3 View

I want to performe MALDI-TOF MS for bacterial identification, I would appreciate it if anyone can tell me the matrix solution preparation protocol ?

based on what I've studied on multiple papers, for peptide and protein identification Alpha-cyano-4-hydroxycinnamic acid (CHCA) is an appropriate matrix to use, I also know that the CHCA powder...

26 February 2021 6,799 3 View

Universal bacterial primers targeting a mRNA?

Hi, I'm looking for universal primers targeting a bacterial mRNA to quatify bacterial load by qPCR in a complexe mixture (eukaryote and prokaryote RNA). Ribosomal RNA being depleted, I absolutly...

22 February 2021 9,969 3 View

Does anyone have any ideas why drug-resistant malaria is increasing in Southeast Asia even when those drugs are no longer used?

When dealing with bacterial toxins, there are three varieties of microbes that develop in your petri dish: toxic, resistant, and susceptible. Initially, there are only toxic and vulnerable...

21 February 2021 6,084 5 View

Could you please share your experience with me on the type of 96 wells plate for MIC determination: Treated Vs Untreated and Round-Vs Flat-bottomed?

I am working on the MIC determination of various antibacterial agents (both water-soluble and- insoluble) against S. aureus, MRSA, and S. pyogenes. Some guidelines recommend using round-bottomed...

17 February 2021 7,029 3 View

What are the best cations for preparing competent cells, Ca2+ or Mg2+?

I have been reading various articles and most state that treatment with CaCl2 produces higher efficiency of transformation than MgCl2. Can anyone explain why Ca2+ is better than Mg2+ at...

16 February 2021 8,519 5 View

How much amount of DNA (ligation mix) should I use for transformation?

Hi Fellow Scientists! I am trying to clone my 300 bp insert into a 6 kb vector. I run a few different ligation reactions using (1:3 vector: insert molar ratios) 10, 20,30, and 40 ng/ul vector...

15 February 2021 9,563 6 View

Plasmid amplification in S2 cell?

When co-transfect S2 cell with selection vector (pCoHygro or pCoBlast ) to make a stable cell line, does the gene integrate into the genome or just like E.coli? How do the plasmids amplify within...

09 February 2021 5,423 1 View

Would using an asRNA for repressing transcription of a high expression Listeria monocytogenes non-coding RNA harbored in a plasmid be a viable option?

Hello all, I am interested in deleting a highly expressed non-coding RNA located on a Listeria monocytogenes plasmid. Currently, there are not any optimized gene deletion methods for Listeria...

09 February 2021 4,994 1 View

Does DNA A-tailing survive after agarose gel electrophoresis and purification?

Hi everyone, I need to clone in pGEM-T vector the result of amplifying a metagenomic library by PCR with a high fidelity polymerase but I only want to clone the fragments of an specific size...

04 February 2021 6,051 8 View

Multiple insertions with Q5 Site-directed mutagenesis?

03 February 2021 221 2 View