Hi Gaurav,

For induction of mutation in your gene of interest, Quick Change PCR is the best one in my opinion, since it is really easy and fast. However you need to have a vector encoding your gene of interest. You just design 2 complementary primers with your desired mutation. If it was fine with you I would further explain it how to do it.

Hello Gaurav,

I have used the protocol available on line for the Quikchange kit. You don't need the kit itself, but using Pfu turbo DNA polymerase and not Phusion or Taq turned out to be critical. As to the design of primers, use their web site : http://www.genomics.agilent.com/primerDesignProgram.jsp

Good luck

Pierre

Hi Gaurav,

Do you intend to generate genomic mutants. If so Quickchange will be perfect to generate the mutated gene on a plasmid first. Then, this mutated gene has to be exchanged in vivo with the wild type genomic copy as described there for instance:

http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2373285/

Dear all, A big thanks for your valuable suggestions. I am exploring some protocols online to get a clear idea on recent advances on the topic.

Dear Dominique Sir, I wish to generate plasmid mutants at the moment. Protocols based on plasmid mutants would be more preferred. 

Hi again.

So, first you need to design a pair of primers complementary to each other. The length of primers better to be between 33-39. (Find the attached file).

Just keep in mind that you have to add each of your primers in a separate microtube (one reaction with FORWARD and another reaction with REVERSE primer) and then run PCR for 6 cycles. Then mix two microtubes and run again for 24 cycles. Otherwise your primers will form dimers.

Also as you want to amplify a long plasmid you have to use strong DNA polymerase which be able to amplify long fragments without any errors.

This is what I used:

98C for 5 min

6 cycle:

98C 1min

66C 45

68C 12min

Then mix the content of two tubes and run 24 cycles more.

I actually disagree with Quickchange being the best option only because the kit is a little pricey and the long primers can sometimes be problematic.  I have routinely used inverse PCR (aka "Round the horn PCR") and then perform a one-pot polynucleotide kinase and T4 ligation reaction.

To use iPCR, you simply have a sense primer and antisense primer pair anneal head-to-head on your template but the 5' region of one in the pair contains your mutation rather than be complementary to your parent plasmid.  The resultant product will be your entire plasmid in linear form with the mutation incorporated into one end.  This is then gel extracted, phosphorylated with PNK and ligated.  I typically get thousands of colonies and don't even bother with the DpnI digest.  Simple, cheap and reliable...only issue is that it's difficult to introduce multiple mutations in one shot unless they are very close together and can be included in a single primer.

If any of this needs clarification or you'd like a protocol, feel free to ask!

Hi 

this is the protocol that I used in my old lab and it worked very well. hope it helps!

Site directed mutagenesis protocol

1.    Design primers:

design the primers according to Zheng, et al. NAR, 2004.  Each primer is ~ 40 bp, and complements each other at 5’ terminus (25-30bp), for examples

GAATATGCAGTGcggACGGTCTTCAAATCCTCCTCGATG  GATTTGAAGACCGTCCGCACTGCATATTCACGGCTCGTC

 2.    Miniprep of plasmid DNA from O/N cultures 

3.    PCR Reaction

A polymerase with relatively high fidelity and high activity is necessary. I use

PhusionTMHigh-fidelity DNA Polymerase from NEB. a 50 µl of PCR reaction:

Plasmid DNA 1 ul

5 X Phusion HF buffer With7.5 mM MgCl2 10ul

 25 µM forward primer  1ul

25 µM reverse primer 1ul

10 mM dNTP  1ul

Phusion DNA Polymerase 0.5ul

Sterilized ddH2O 35.5ul

PCR condition:

   98°C for 3 minutes

   98°C for 10 seconds

   55°C for 30 seconds

   72°C for 8 minutes

Repeat previous three steps 4 times. Then,

   98°C for 10 seconds

   60°C for 30 seconds

   72°C for 8 min

Repeat previous three steps 12 times. Then,

   72°C for 10 minutes

   4°C indefinitely

4.    optional: Purify PCR product with QIAquick PCR purification kit.

 5.    Digest PCR product with Dpn1:

50 uL of PCR products

2uL of Dpn1 20 U/uL

Incubate at 37 C for 3-5 hours

7.    Transform 2-3 uL into E. coli competent cells.

I thought I would add that beta-lactamase has been extensively studied by mutagenesis. So before making new mutants I would see if the ones you are interested in have already been made and described in the literature.