the following is a part of an assignment I need to complete, but I dont know where to even start with this bit. Can anyone help? I assume I would need to work out what type of metaboliser he is for starters but not sure how to do this?
' You found that the DNA sequence of 7th exon on the CYP2D6 gene from Paul as below, please explain whether he should take prescribed methadone like most of other adults? Explain your reason.
ACCGTGTCCAACAGGAGATCGACGACGTGATAGGGCAGGTGCGGCGACCAGAGATGGGTGACCAGGCTCACATGCCCTACACCACTGCCGTGATTCATGAGGTGCAGCGCTTTGGGGACATCGTCCCCCTGGGTGTGACCCATATGACATCCCGTGACATCGAAGTACAGGGCTTCCGCATCCCTAAG'
k.p���"Q�
Try OMIM.
https://www.omim.org/entry/124030?search=P450%202D6-like&highlight=like%202d6like%20p450
First, align this sequence with reference seq of exon 7 of CYP2D6. Check if there is any mutation. Use in-silico tools to translate the mutated transcript. Use nomenaclature tools to formulate the correct mutation name and position. Then look at databases such as HGMD or OMIM to see if this is a known disease causing mutation and what would be the right treatment
Ultimately it depends whethet any SNP in the seq has a phenotypic correlation to either hyper or hypometabolism. This would have an effect on the patient satisfaction under methadone treatment.
Check this out:
https://www.ncbi.nlm.nih.gov/m/pubmed/17234366/
Okay, so I have found the reference sequence for exon 7 on CYP2D6 (i think) and the different between this sequence and the sequence I have been given in that the reference has a G and mine has a A right at the start. it is the only change.... Where do I go from here please?
- Badges
- Science topic
- Similar topics
- Philosophy
- Philosophy Of Science
- Reasoning