15 March 2018 3 6K Report

the following is a part of an assignment I need to complete, but I dont know where to even start with this bit. Can anyone help? I assume I would need to work out what type of metaboliser he is for starters but not sure how to do this?

' You found that the DNA sequence of 7th exon on the CYP2D6 gene from Paul as below, please explain whether he should take prescribed methadone like most of other adults? Explain your reason.

ACCGTGTCCAACAGGAGATCGACGACGTGATAGGGCAGGTGCGGCGACCAGAGATGGGTGACCAGGCTCACATGCCCTACACCACTGCCGTGATTCATGAGGTGCAGCGCTTTGGGGACATCGTCCCCCTGGGTGTGACCCATATGACATCCCGTGACATCGAAGTACAGGGCTTCCGCATCCCTAAG'

k.p���"Q�

More Tiff Jayne's questions See All
Similar questions and discussions