Do you have the real time amplification results?

Hi,

You have Primer dimers even on your amplified samples. Try to lower Primer concentration.

Use many Primer concentration.

Hi,

1. Reverse Transcriptase is not working. Why? how to verify?

If you have plasmid used for making IVT RNA you can run that in parallel, if the plasmid amplifies, you can confirm issue is with RT.

2. Positive Control ARN (RNA) is degraded. Why? how verify?

Have you quantified your IVT RNA? Multiple freeze thaw can degrade RNA.

What was the input concentration?

3. Other issue? any ideas?

Do you have any confirmed positive and negative samples? Please run that and check.

Hope this helps.

Donato Fernandez

You can work on the following factors as multiplexed RT- PCR to discriminate its products by

- melt curve

- by wavelengths etc.

- Sequence specific length / TaqMan probe conc. Primer concentrations.

Chemistry design, data processing and analysis techniques to be worked on again and check the protocol.

Have you tried Reverse Transcriptase from different sources to verify that the known one is working??

Please read the following Link would help you to find out the root cause systematically !! All the best !

https://www.nature.com/articles/s41598-018-37732-y

Hi,

Is your target RdRp gene? I had issue with a gblock ordered from EVAg.

If that is your positive control you should have something else. It was working for me as well before.

Best

I think you can run a second amplification using the PCR products of the 1st run as a template to verify the results and resend the results so we can help you.

Rixun Fang no. Im performin a end-point PCR that is why im doing the electrophoresis. Thank you for your reply.

Hello Isam Alkhalifawi and Kaan Hürkan That is one of my fears. But how do you conclude that? What makes you think that? This are my primers/probes:

>ORF1ab SARS-Cov2 Forward

CCCTGTGGGTTTTACACTTAA

>ORF1ab SARS-Cov2 Reverse

CCGTTTAAAAACGATTGTGCATCA

>ORF1ab Probe FAM

CCGTCTGCGGTATGTGGAAAGGTTATGG

>N SARS-Cov2 Forward

TTACAAACATTGGCCGCAAA

>N SARS-Cov2 Reverse

GCGCGACATTCCGAAGAA

>N SARS-Cov2 Probe VIC

ACAATTTGCCCCCAGCGCTTCAG

>RNase P Human gene Forward

AGATTTGGACCTGCGAGCG

>RNase P Human gene Reverse

GAGCGGCTGTCTCCACAAGT

>RNase P Human gene Probe CY5

TTCTGACCTGAAGGCTCTGCGCG

I will try lower concentrations. Thank you for your answerd!

Hello Ajith Kumar

1. No I don't have the Plasmid. It is just the kit.

2. The Concentration for primers are: 0.4uM for primers and 0.1uM for Probes. The protocol say "add 5ul" of the positive control to the 20ul reaction (pcr mix+rt+primers). I do not quantified. I can quantified by electroforesis to see rRNA 28S and rRNA 18S bands. But do you think it will work? I don't know if this IVT RNA is "complete" or just has the genes. Is that possible?

3. I don not have a positive confirmed sample. But those samples in the image are confirmed negatives.

Thank you for your reply!

Anju Kaushal I will read that. thank you!

Luca Miglietta it is not from Evag. Thank you

Eman El-Abd I will do! Thank you!

Hi, Donato Fernandez and all others.

In order to help you, I need to ask you one other thing.

In your request for help you said something about not having a realtime Thermocycler. So, Are you using a RT-qPCR commercial kit to perform an endpoint PCR. Right?

If so (and I think it is), probably, your problem is laying on your thermocycler ramping speed ... Normal endpoint machines usually have less than 5ºC ramping speed in both courses (way up and way down the temperature), differently of realtime ones ... So, If I am right about it, you need to give more time for denaturing and probably all other temps in our protocol (not that bad about the extension time). Ok?

You wrote:

The protocol specified by the manufacturer is a one-step RT-PCR program:

1 cycle at 50°C for 5 min (Reverse Transcription) (I've never seeing any protocol so short)

1 cycle at 95°C for 30s (Pre-denaturation. Actually, elimination of RT enzyme and activation of the polymerase)

45 cycles of:

95°C for 5s (Denaturation) (Usually on realtime machines with fast PCR. Not compatible with normal endpoint machines)

60°C for 30s (PCR cycling)

My opinion:

A more appropriate protocol for your situation:

1 cycle at 50°C for 5 min (Reverse Transcription) (I do think it is too fast ... I would change to 20 min)

1 cycle at 95°C for 30s (Pre-denaturation) (Check IF this polymerase is a hot start one or not. If it is it should require something from 2 - 15 min, depending on the brand)

45 cycles of:

95°C for 5s (Denaturation) (at least 30s)

60°C for 30s (PCR cycling) (I think it is ok but maybe it will be necessary to perform it as a three step PCR 60ºC - 30 sec and 72ºC - 30 sec for every cycle).

It may need more tests in order to achieve optimal protocol.

I hope it may help you!

Best of luck and, please, publish your result here if it helps you in order to let us all know. OK?

All the best.

Hello Adriano Costa de Alcantara . Yes, you are right, im using a RT-qPCR commercial kit to perform an endpoint PCR.

My thermocycler has 2 ºC/s way up and 0.7 ºC/s way down. I attached the graphs. It is very uggly.

But, the time of a phase is start counting when the block reaches the desired temp. So I think the sample is always at desided temp for the desired time anyway (maybe more because the slow way down ramp). Do you think the problem is what you mention anyway knowning this feature?

On my last test I accidentally put reverse transcriptiontime for 10mins and I get betther results. But at the same time I decrease the primers concentration so I don't know which change was the key (also use 37 cycles instead of 35)

I'm still not happy with the result. I don't like the bands at ~40pb. They are primers? Primer dimer? It is normal see them there?

so I will continue testing...

Thanks to everybody!

Hi, Donato Fernandez

I'm sorry for the delay. I've been very busy lately.

Ok, I am happy my evaluation got the right way on what you're doing.

Answering the points you talked about ...

My thermocycler has 2 ºC/s way up and 0.7 ºC/s way down. I attached the graphs. It is very uggly.

Answer - So, quite different from realtime machines (thermocyclers).

But, the time of a phase is start counting when the block reaches the desired temp. So I think the sample is always at desided temp for the desired time anyway (maybe more because the slow way down ramp). Do you think the problem is what you mention anyway knowning this feature?

Answer - Yes, It is still a problem because you let samples for longer times in between the temps you really need and polymerase works in a different way. Take a look at this short but detailed data about major problems when using different equipments (https://www.thermofisher.com/br/en/home/life-science/cloning/cloning-learning-center/invitrogen-school-of-molecular-biology/pcr-education/pcr-thermal-cyclers/pcr-thermal-cyclers-considerations.html).

On my last test I accidentally put reverse transcriptiontime for 10mins and I get betther results. But at the same time I decrease the primers concentration so I don't know which change was the key (also use 37 cycles instead of 35)

I'm still not happy with the result.

Answer - you"re right, You still need to work on it till you can say you standardized it.

I don't like the bands at ~40pb. They are primers? Primer dimer? It is normal see them there?

Answer - Yes, it's normal but tell us also you're using, maybe, too much primer ...

Other thing, when you work with realtime thermocyclers and reagents, they use more magnesium than standadr reaction and reaqents ... So, your image on a gel, usually, gets more blurry as the one you're having. Although, I guess you need to optimize the imaging details of your image detection system. Ok?

So, my last advice for now is organize your ideas and then decide the tests you will need to do with this kit and thermocycler in order to figure out the best protocol and loose the minimal amount of RT-qPCR kit as possible. My opinion is:

1 - increase (as you already did) the amount of time for RT reaction (Check the RT reagents from the same company or get in touch to someone at the company/brand you bought your kit and talk about it);

2 - Check the molarity of your primers in the reaction (usually you get a mix of primers and probes in this case) but, If they tell you the amount (0.4uM primers and 0.1uM probe), maybe you can inout only half or thid part of it and see what happens;

3 - Test a three-step PCR after RT or a 2-step, both with standard PCR times (Check with the company or other kits they have with product (amplicon) sizes similar to the ones you're performing with Sars-CoV-2 to define your own Steps time. Ok?

I hope to help you.

Anyway, think about the costs and time to get new kits to do it. Ok? Another possibility is to order some other kit properly designed for endpoint analysis.

All the best.

P.S.

One other thing, How many cycles do the original protocol recommend? Usually, for realtime reactions, companies recommend 40 to 45 cycles, instead of 35. Are you sure it is 35 cycles?

P.S.2

Another link that explains and gives you the same answer I gave.

https://www.bio-rad.com/en-us/applications-technologies/pcr-troubleshooting?ID=LUSO3HC4S

Here you can read:

Thermal cycler ramping speed is too slow If the ramp speed of the cycler is too slow, spurious annealing may occur due to lower temperature and sufficient time for nonspecific binding. If ramping speed is not set at the maximum speed for the cycler, increase to maximum ramp rate.

I would add: and decrease annealing (and maybe extension) time(s).

All the best.

Hello Adriano Costa de Alcantara thank you very much for your time, answers and links they are was helpful.

Regarding your P.S.1, yes the original protocol recommend 45 cycles. But I did 37 the last time because first time I use 45 and I got very degraded image in electrophoresis. I thought DNA was very degraded with 45 cycles so I reduced the cycles to 37. But now I know that less primers are working I will try with 45 cycles again.

thank you again!

Hi, Donato.

You're more than welcome and I'm more than happy to know I could give some help.

Last but not least, If our support helped you, let us know if you got good results and share your final protocol. If it is not a problem. Ok?

All the best.