I'm doing research on telomere ( which located at the ends DNA, protect the genetic data and make it possible for cells to divide, and hold some secrets to how we age and get chronic diseases) using singleplex method in qPCR (QuantiStidu5) instrument. Our strategy for determining relative telomere lengths to measure for each sample, the factor by which the sample differs from reference DNA in its ratio of telomere repeat copy number to single copy gene copy number
First i tried using SYBR Qreen master mix from applied biosystems. but I'm not getting good amplifications product and also there was primer-dimmer formation. I change mix to Eva Green master mix-LR. I've been getting good amplification product (ct between 8-22) and good melting curve with one peak but unfortunately always getting product in non template control(NTCs).
I have tried replacing everything including ordering new primers, Nucleas free water, and DNA zap. And also cleaning all pipettes and work site using bleach and ethanol and set up my PCR on Laminar flow wood, but I can't get ride of it!
I've even got a lab member to run the PCR for me with his separate equipments and still he got products in NTCs.
: I tried to use two type of primers for telomere
teloF: CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGG TTTGGGTT
teloR: GGCTTGCCTTACCCTTACCCTTACCC TTACCCTTACCCT
telgF: ACACTAAGGTTTGGGTTTGGGTTTGGGTTTGGGTTAGTGT
telgR: TGTTAGGTATCCCTATCCCTATCCCTATCCCTATCCCTAACA
Primer for single copy gene
36B4F; CAGCAAGTGGGAAGGTGTAATCC
36B4R:
CCCATTCTATCATCAACGGGTACAA
Any suggestions on what might be the source and how to deal with it??. Otherwise thank you in advance.
Hi Alaaldin,
I have tried to check the possible dimer formation using Pridimer check (http://biocompute.bmi.ac.cn/MPprimer/primer_dimer.html). There were many primer dimers that can form, as is obvious from the primer sequences itself. Although I cannot tell you to redesign the primers, you can refer to any similar study and find out how they designed primers. As long as dimers form, SYBR green or any DNA binding dye can cause fluorescence. I hope this will help you.
Hi Alaaldin,
1. Did you get any NTC amplification with SYBR-Green? If no, I think it is safe assume that your primers are okay. If the primers were wrong, you would have got amplification with SYBR-Green too.
2. For Eva-Green, were the Ct-values same for both Sample and NTC ? or are the NTC Ct-values are >35? If Ct-values are
- Badges
- Science method