Hi all, I would like to seek yr expert opinion on the universal primers used to sequence PUC19. Is it M13F (-20) and M13R (-26)? The company that i sent to seem to have alot of primers of M13. Please advice
PUC19 contains part of M13. M13F and M13R will give you sequence from both directions.
https://www.addgene.org/50005/
As already pointed out, the M13 primers will work. Both vectors share a part of the backbone belonging to LacZ common to many vectors.
PUC19 universal primers (F/R) are however different than M13 (F/R)
Universal Forward 20mer 5' GTTGTAAAACGACGGCCAGT 3'
Universal Reverse 20mer 5' CACAGGAAACAGCTATGACC 3'
Universal Forward 20mer corresponds to 376-395 gb L09137 PUC19
M13F (-20) and M13R (-26) are the primers used by the lab that does our sequencing. But i'll assume that any M13 primers should work fine. it depends of how far they are from your insert.
- Badges
- Science method