Having selected three primers, matK, ITS and psbA-trnH; I noticed that the forward and reverse primer sequence does not align and compliment each other.
Primers
1. matK mIF Forward internal (5′-GTT CAG TAC TTG TGA AAC GTT-3′) matK mIR Reverse internal (5′-CGT TTC ACA AGT ACT GAA CTA-3′) (Kress et.al., 2002)
2. psbA-trnH primers Forward psbA3_f (GTTATGCATGAACGTAATGCTC) Sang et al. 1997, trnHf_05 Reverse (CGCGCATGGTGGATTCACAATCC) Tate & Simpson, 2003.
Kindly provide reasons for this.
primer sequences for PCR are never complementary to each other or they would not amplify and just form a double stranded primer sequence. They will anneal some hundreds of bases apart and facing each other to form a product that lies between the 2 primers. Do not worry they will work if they have worked in the past for other researchers
primer sequences for PCR are never complementary to each other or they would not amplify and just form a double stranded primer sequence. They will anneal some hundreds of bases apart and facing each other to form a product that lies between the 2 primers. Do not worry they will work if they have worked in the past for other researchers
Primer sequences are complementary to the region of DNA you want to amplify and are NOT complementary to each other. In fact, primers that are each other's reverse complement will bind to each other and your reaction will NOT work. Learn the basics on PCR before you start any experiments. I show these videos to my students when they are just learning https://www.youtube.com/watch?v=iQsu3Kz9NYo
https://www.youtube.com/watch?v=2KoLnIwoZKU
Thanks, I was able to figure this out. If complimentary, they will form Primer dimers.
- Badges
- Science method