Does anyone have validated primers for QPCR on SFG retrovirus transduced cells?
My goal is to calculate retro copy number in transduced cells, and for eventual titration of retroviral sup.
For the latter simple titration by flow cytometry may suffice (e.g. if 2% gfp: 0.02 X 50,000 HEK-293T transduced: 1000 in a certain volume used, then adjust per mL).
For the first goal, I designed some primers after the 5' LTR, however not only they amplified a band in untransduced Jurkat, but I see also either a dimer or an aspecific band. However, I did observe a single melting curve by PCR (not shown). -The different intensities of the band is simply due to a loading effect.
Therefore, I redesigned new primers using the software from Sigma. Not sure if the software checks automatically for specificity against the human genome (blastN?).
Item Name:retro F Sigma 62 Sequence:TCC GAT TGT CTA GTG TCT ATG A Item Name:retro R sigma 63 Sequence:GGT CCG CCA GAT ACA GAG
When run on Blast N vs the human genome they had E value of 15 and 24 resp. against two separate genes.
https://blast.ncbi.nlm.nih.gov/Blast.cgi
https://blast.ncbi.nlm.nih.gov/Blast.cgi
(first 200bp after the 5' LTR: TTTGGGGGCTCGTCCGGGATCGGGAGACCCCTGCCCAGGGACCACCGACCCACCACCGGGAGGTAAGCTGGCCAGCAACTTATCTGTGTCTGTCCGATTGTCTAGTGTCTATGACTGATTTTATGCGCCTGCGTCGGTACTAGTTAGCTAACTAGCTCTGTATCTGGCGGACCCGTGGTGGAACTGACGAGTTCGGAACAC)
In doing so, I was unable to match the 55Tm of the albumin primers, derived from Mol Biotechnol (2015) 57:195–200,and therefore I will have to perform 2 separate PCR run.
Also, I will need to clone the human albumin gene (introns and exons?) in order to use that plasmid to buils a standard curve, rather then using genomic DNA.
I appreciate any input.
Thank you.
PS those were the primers used for the previous run:
Item Name:LTR F new 55 Dec19 Sequence:TTC ATT TGG GGG CTC GT Item Name:LTR R new 55 Dec19 Sequence:ACA CAG ATA AGT TGC TGG C
- Badges
- Science method