I recommend you to use first 20 to 25  base of each end and check them in following site http://sg.idtdna.com/calc/analyzer, then perform blast to check their specificity in your organisms.

you need to check GC content, TM point and other criteria as well. 

you have no choice as you need the whole sequence so just test the end sequences for similar Tm and also high Tm as your sequence contains runs of Gs so formation of G quadruplexes may be a problem so you want to keep the minimum temperature high at all times. I would design the lengths for a Tm above 65 and use a hot start enzyme. High annealing temperatures also minimise the random errors near the primers cause by the enzyme working during annealing and introducing errors.  The sequence is quite high GC so if it works badly then amplify in 1M betaine to make it melt easier and minimise secondary structure, Remember if you are sequencing that nothing under the primers can be sequenced because the primer is always incorporated into the amplimer

   I would have used ACTTGCAACAGTCCTAACATTCACCTC as forward primer and reverse of CTCAGGTCGGCCGACTGCGGCACAGTTTTTTG as reverse primer. But nowadays I would order a synthetic sequence from e.g. GeneArt. Should cost around 200 $ and thus is much cheaper and less time consuming than doing all manually.

Best,

Günther

Guenther's answer also has the great advantage that the sequence will be perfect while amplified sequences will have changes close to the primers even with high fidelity enzymes

It would be a too easy answer to take primers from outside the sequence. Therefore, I assume that the sequence upstream and downstream of your target is not known? That's why, I recommended Guenther's answer. (+1)

Guenther provides you with an excellent option.

I strongly encourage you to follow Bahram's advise as well.

I have had great success with analyzing my primer choice in MacVector to check for possible problems before spending the money on a synthetic sequence. The Oligo Analyzers can prevent a lot of headaches.

Thank you all for the information. It looks that for my purpose on this sequence, primers always have some chance of having secondary structures. I am using all of your suggestions to work on the other sequences. Thank you again!