Genomic DNA with optimum quality (Quality checked on Nanodrop)
Amplification is late at 25-28 cycles, we are unsure of the meaning behind this pattern (Is it bad? - Not a big deal?)
I am using SYBR
Primers are for a conserved region (Confirmed by my PI)
Forward: CTGCGACTCGAACTTGGGTAGG
Reverse: GCTGCGCAAACAGTTCCTGAAG
Primers are at 35uM
Annealing temp is at 60 degrees celsius (I attached my thermal profile)
Is that within the detectable range of your standard curve? If yes and your primers have 95-105% efficiency, then I'd say your overall DNA concentration is just low. Not a problem as long as you've used all the proper controls.
I guess I’m unsure on what the proper concentrations should be. I did do a run with dilutions but that made it amplify even later so I would say you’re correct on the low concentration. But even when I did that a standard curve wasn’t generated. Does the system automatically generate it for you or is it something you you do in setup? I’m using Mxpro Mx3000p
Most folks use linearized plasmid that contains their gene of interest to create the standard curve. You can use it for either relative or absolute expression (depending on if you know the exact copy number of plasmids or just relative concentration).
- Badges
- Science method